Address of the bookmark: https://github.com/knausb/vcfR

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

CPAT - https://github.com/liguowang/cpat, http://lilab.research.bcm.edu/ (web server)

CPC2 - https://github.com/gao-lab/CPC2_standalone, http://cpc2.gao-lab.org/ (web server)

Infernal - http://eddylab.org/infernal/, https://github.com/EddyRivasLab/infernal

NCBI RefSeq - https://www.ncbi.nlm.nih.gov/refseq/

Rfam - http://rfam.xfam.org/, https://docs.rfam.org/en/latest/index.html

SILVA - https://www.arb-silva.de/

RNAmmer - http://www.cbs.dtu.dk/services/RNAmmer/ (web server, standalone download link)

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

• BigDataScript – A cross-system scripting language for working with big data pipelines in computer systems of different sizes and capabilities. [ paper-2014 | web ]
• Bpipe – A small language for defining pipeline stages and linking them together to make pipelines. [ web ]
• Common Workflow Language – a specification for describing analysis workflows and tools that are portable and scalable across a variety of software and hardware environments, from workstations to cluster, cloud, and high performance computing (HPC) environments. [ web ]
• Cromwell – A Workflow Management System geared towards scientific workflows. [ web ]
• Galaxy – a popular open-source, web-based platform for data intensive biomedical research. Has several features, from data analysis to workflow management to visualization tools. [ paper-2018 | web ]
• Nextflow (recommended) – A fluent DSL modelled around the UNIX pipe concept, that simplifies writing parallel and scalable pipelines in a portable manner. [ paper-2018 | web ]
• Ruffus – Computation Pipeline library for python widely used in science and bioinformatics. [ paper-2010 | web ]
• SeqWare – Hadoop Oozie-based workflow system focused on genomics data analysis in cloud environments. [ paper-2010 | web ]
• Snakemake – A workflow management system in Python that aims to reduce the complexity of creating workflows by providing a fast and comfortable execution environment. [ paper-2018 | web ]
• Workflow Descriptor Language – Workflow standard developed by the Broad. [ web ]

This package is a loose collection of scripts. To run the correction
routine see the section below. Descriptions of the other scripts
are at the bottom of this file.

Contact: gurtowsk@cshl.edu

In short, the correction algorithm takes as input the unitigs from a short read assembly and uses them to correct long read data. More background information for the algorithm can be found:
http://schatzlab.cshl.edu/presentations/2013-06-18.PBUserMeeting.pdf

Address of the bookmark: https://github.com/jgurtowski/ectools

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

Take a look at the PRICE software from the DeRisi lab. Its meant to do something very similar. http://derisilab.ucsf.edu/index.php?page=software

You could also look at SSPACE (http://www.baseclear.com/landingpages/basetools-a-wide-range-of-bioinformatics-solutions/sspacev12/), ATLAS tools (http://www.hgsc.bcm.tmc.edu/content/bcm-hgsc-software), and SCARPA (http://compbio.cs.toronto.edu/hapsembler/scarpa.html).

See the PAGIT protocol: http://www.sanger.ac.uk/resources/software/pagit/

In particular, take a look at the IMAGE tool: http://genomebiology.com/2010/11/4/R41

Also SOAPdenovo has ha function for scaffolding. Not sure about ABYSS

Here there is a useful explanation of several tools.

https://bioinformaticsonline.com/search?q=scaffolding&entity_type=object&entity_subtype=bookmarks&offset=0&search_type=entities

I could be wrong, but the above answers to your hypothetical scenario appear to miss the point that you aren't interested in assembling the full genome, just the 100 kb part you're interested in. I suggest the following algorithm:

1. Start with the initial assembly C0 of the contigs you have identified as overlapping your region of interest, and the set S of reads those contigs contain. Let C = C0.

2. Repeat:
a. Identify paired-end reads (not in C) for which one or both ends align within, or extending, contigs in C.
b. Identify unpaired reads that align extending these new paired-end reads.
c. Construct a new assembly C' from C and the new reads identified in (a) and (b).
d. Trim C' so it does not extend more than 100 kb to either end of C0. Set C = C'.
e. Let S' denote the reads that contribute to C'. If S' does not contain any reads not present in S, stop. Otherwise, Set S = S'.

3. If you don't have a complete assembly of the region of interest, generate an STS for each end of each contig, probe a library for clones including these STSes, subclone these clones into a paired-end sequencing vector, and generate paired-end reads for this library; then try steps (1) and (2) again, adding these new sequencing reads to what you had before.

4. If your average sequencing depth for the region of interest exceeds 25 or so without filling all gaps, it is likely that the remaining gaps represent sequences that are not getting cloned in your sequencing vectors. Try different sequencing vectors.

Address of the bookmark: https://www.molinspiration.com/