More at https://jobs.sanger.ac.uk/vacancy/senior-bioinformatician-assembly-moore-aquatic-symbiosis-project-tree-of-life-458923.html

Effective July 10, 2023, NCBI’s Assembly and Genome record pages now redirect to new NCBI Datasets pages. As previously announced, these updates are part of our ongoing effort to modernize and improve your user experience. NCBI Datasets is a new resource that makes it easier to find and download genome data.   

The following pages have been updated:

• The NCBI Assembly record pages now redirect to the new NCBI Datasets Genome record pages that describe assembled genomes and provide links to related NCBI tools such as Genome Data Viewer and BLAST.  
• The NCBI Genome record pages now redirect to the NCBI Datasets Taxonomy record pages that provide a taxonomy-focused portal to genes, genomes, and additional NCBI resources.   

During this transition, you will have the option to return to the legacy Genome and Assembly record pages. We will remove the legacy pages in early 2024.  

Address of the bookmark: https://github.com/cchauve/lrcstats

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Address of the bookmark: http://omega.omicsbio.org/

So far miniasm is in early development stage. It has only been tested on a dozen of PacBio and Oxford Nanopore (ONT) bacterial data sets. Including the mapping step, it takes about 3 minutes to assemble a bacterial genome. Under the default setting, miniasm assembles 9 out of 12 PacBio datasets and 3 out of 4 ONT datasets into a single contig. The 12 PacBio data sets are PacBio E. coli sample, ERS473430, ERS544009, ERS554120, ERS605484, ERS617393, ERS646601, ERS659581, ERS670327, ERS685285, ERS743109 and a deprecated PacBio E. coli data set. ONT data are acquired from the Loman Lab.

For a C. elegans PacBio data set (only 40X are used, not the whole dataset), miniasm finishes the assembly, including reads overlapping, in ~10 minutes with 16 CPUs. The total assembly size is 105Mb; the N50 is 1.94Mb. In comparison, the HGAP3produces a 104Mb assembly with N50 1.61Mb. This dotter plot gives a global view of the miniasm assembly (on the X axis) and the HGAP3 assembly (on Y). They are broadly comparable. Of course, the HGAP3 consensus sequences are much more accurate. In addition, on the whole data set (assembled in ~30 min), the miniasm N50 is reduced to 1.79Mb. Miniasm still needs improvements.

Miniasm confirms that at least for high-coverage bacterial genomes, it is possible to generate long contigs from raw PacBio or ONT reads without error correction. It also shows that minimap can be used as a read overlapper, even though it is probably not as sensitive as the more sophisticated overlapers such as MHAP and DALIGNER. Coupled with long-read error correctors and consensus tools, miniasm may also be useful to produce high-quality assemblies.

Minimap and miniasm are ultrafast tools for (i) mapping and (ii) assembly. Designed for long, noisy reads, they do not have a correction or consensus step, and therefore the resulting assemblies are contiguous (i.e. long) but very noisy (i.e. full of errors)

We start with an all against all comparison:

minimap -Sw5 -L100 -m0 -t8 reads.fq reads.fq | gzip -1 > reads.paf.gz

Then we can assemble

miniasm -f reads.fq reads.paf.gz > reads.gfa

Convert GFA to FASTA:

awk '/^S/{print ">"$2"\n"$3}' reads.gfa | fold > reads.fa

And then count how many contigs:

grep ">" reads.fa | wc -l

# Download sample PacBio from the PBcR website
wget -O- http://www.cbcb.umd.edu/software/PBcR/data/selfSampleData.tar.gz | tar zxf -
ln -s selfSampleData/pacbio_filtered.fastq reads.fq
# Install minimap and miniasm (requiring gcc and zlib)
git clone https://github.com/lh3/minimap && (cd minimap && make)
git clone https://github.com/lh3/miniasm && (cd miniasm && make)
# Overlap
minimap/minimap -Sw5 -L100 -m0 -t8 reads.fq reads.fq | gzip -1 > reads.paf.gz
# Layout
miniasm/miniasm -f reads.fq reads.paf.gz > reads.gfa

Address of the bookmark: https://github.com/lh3/miniasm

Address of the bookmark: https://github.com/marbl/MashMap

https://github.com/ggonnella/rgfa

Address of the bookmark: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5103826/

https://www.nature.com/articles/nmeth.4432

Address of the bookmark: https://github.com/xiaochuanle/MECAT