BOL: Related items

GoJS

Jit — Tue, 22 Nov 2016 08:25:37 -0600

GoJS is a feature-rich JavaScript library for implementing custom interactive diagrams and complex visualizations across modern web browsers and platforms. GoJS makes constructing JavaScript diagrams of complex nodes, links, and groups easy with customizable templates and layouts.

GoJS offers many advanced features for user interactivity such as drag-and-drop, copy-and-paste, in-place text editing, tooltips, context menus, automatic layouts, templates, data binding and models, transactional state and undo management, palettes, overviews, event handlers, commands, and an extensible tool system for custom operations.

GoJS is pure JavaScript, so users get interactivity without requiring round-trips to servers and without plugins. GoJS normally runs completely in the browser, rendering to an HTML5 Canvas element or SVG without any server-side requirements. GoJS does not depend on any JavaScript libraries or frameworks, so it should work with any HTML or JavaScript framework or with no framework at all.

More at http://gojs.net/latest/index.html

Address of the bookmark: http://gojs.net/latest/index.html

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

JumboDB: tool for de Bruijn graph construction

BioStar — Tue, 17 Aug 2021 13:33:46 -0500

jumboDB tool for fast de Bruijn graph construction from long sequences (reads or genomes) with very low error rate. JumboDB is not a genome assembler by itself but rather a subroutine that translates a set of reads into compressed de Bruijn graph.

More at https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/AntonBankevich/jumboDB

GFAffix : Identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

BioStar — Thu, 28 Aug 2025 03:11:25 -0500

GFAffix identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

Address of the bookmark: https://github.com/codialab/GFAffix

Unicycler: Hybrid assembly pipeline for bacterial genomes

Jit — Fri, 10 Nov 2017 03:58:27 -0600

Unicycler is an assembly pipeline for bacterial genomes. It can assemble Illumina-only read sets where it functions as a SPAdes-optimiser. It can also assembly long-read-only sets (PacBio or Nanopore) where it runs a miniasm+Racon pipeline. For the best possible assemblies, give it both Illumina reads and long reads, and it will conduct a hybrid assembly.

Address of the bookmark: https://github.com/rrwick/Unicycler

HapCUT2: robust and accurate haplotype assembly for diverse sequencing technologies

Jit — Tue, 15 May 2018 07:35:26 -0500

HapCUT2 is a maximum-likelihood-based tool for assembling haplotypes from DNA sequence reads, designed to "just work" with excellent speed and accuracy. We found that previously described haplotype assembly methods are specialized for specific read technologies or protocols, with slow or inaccurate performance on others. With this in mind, HapCUT2 is designed for speed and accuracy across diverse sequencing technologies, including but not limited to: NGS short reads (Illumina HiSeq) clone-based sequencing (Fosmid or BAC clones) SMRT reads (PacBio) Oxford Nanopore reads 10X Genomics Linked-Reads proximity-ligation (Hi-C) reads high-coverage sequencing (>40x coverage-per-SNP) using above technologies combinations of the above technologies (e.g. scaffold long reads with Hi-C reads) See below for specific examples of command line options and best practices for some of these technologies. NOTE: At this time HapCUT2 is for diploid organisms only. VCF input should contain diploid variants. If you use HapCUT2 in your research, please cite: Edge, P., Bafna, V. & Bansal, V. HapCUT2: robust and accurate haplotype assembly for diverse sequencing technologies. Genome Res. gr.213462.116 (2016). doi:10.1101/gr.213462.116

Address of the bookmark: https://github.com/vibansal/HapCUT2

transrate: Understanding your transcriptome assembly

Neel — Fri, 13 Jul 2018 07:49:26 -0500

Transrate is software for de-novo transcriptome assembly quality analysis. It examines your assembly in detail and compares it to experimental evidence such as the sequencing reads, reporting quality scores for contigs and assemblies. This allows you to choose between assemblers and parameters, filter out the bad contigs from an assembly, and help decide when to stop trying to improve the assembly.

Address of the bookmark: http://hibberdlab.com/transrate/index.html

ALLHiC: Phasing and scaffolding polyploid genomes based on Hi-C data

BioStar — Thu, 20 Dec 2018 12:03:32 -0600

The major problem of scaffolding polyploid genome is that Hi-C signals are frequently detected between allelic haplotypes and any existing stat of art Hi-C scaffolding program links the allelic haplotypes together. To solve the problem, we developed a new Hi-C scaffolding pipeline, called ALLHIC, specifically tailored to the polyploid genomes. ALLHIC pipeline contains a total of 5 steps: prune, partition, rescue, optimize and build.

Address of the bookmark: https://github.com/tangerzhang/ALLHiC/wiki

SvABA: Genome-wide detection of structural variants and indels by local assembly

Abhimanyu Singh — Mon, 21 Jan 2019 17:58:56 -0600

SvABA is a method for detecting structural variants in sequencing data using genome-wide local assembly. Under the hood, SvABA uses a custom implementation of SGA (String Graph Assembler) by Jared Simpson, and BWA-MEM by Heng Li. Contigs are assembled for every 25kb window (with some small overlap) for every region in the genome. The default is to use only clipped, discordant, unmapped and indel reads, although this can be customized to any set of reads at the command line using VariantBam rules. These contigs are then immediately aligned to the reference with BWA-MEM and parsed to identify variants. Sequencing reads are then realigned to the contigs with BWA-MEM, and variants are scored by their read support.

Address of the bookmark: https://github.com/walaj/svaba

NextDenovo: string graph-based de novo assembler for TGS long reads

Jit — Sun, 05 Jan 2020 04:08:29 -0600

NextDenovo is a string graph-based de novo assembler for TGS long reads. It uses a "correct-then-assemble" strategy similar to canu, but requires significantly less computing resources and storages. After assembly, the per-base error rate is about 97-98%, to further improve single base accuracy, please use NextPolish.

NextDenovo contains two core modules: NextCorrect and NextGraph. NextCorrect can be used to correct TGS long reads with approximately 15% sequencing errors, and NextGraph can be used to construct a string graph with corrected reads. It also contains a modified version of minimap2 for adapting input and output and producing more sensitive and accurate dovetail overlaps, and some useful utilities (see here for more details).

Address of the bookmark: https://github.com/Nextomics/NextDenovo