<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43791?offset=500</link>
	<atom:link href="https://bioinformaticsonline.com/related/43791?offset=500" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/4288/new-born-babies-get-ready-to-know-their-whole-genome-soon</guid>
	<pubDate>Thu, 05 Sep 2013 07:24:02 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/4288/new-born-babies-get-ready-to-know-their-whole-genome-soon</link>
	<title><![CDATA[New born babies get ready to know their whole genome soon!!!]]></title>
	<description><![CDATA[<p>USA launch a pilot projects to examine medical information of newborn baby, which are being funded by the Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) and the National Human Genome Research Institute (NHGRI), both parts of the National Institutes of Health.</p><p>Awards of $5 million to four grantees have been made in fiscal year 2013 under the Genomic Sequencing and Newborn Screening Disorders research program. The program will be funded at $25 million over five years, as funds are made available.</p><p>"Hundreds of US babies will be pioneers in genomic medicine through a&nbsp;US$25-million programme to sequence their genomes&nbsp;soon after they are born."</p><p><strong>Source</strong>:</p><p><a href="http://blogs.nature.com/news/2013/09/scientists-to-sequence-hundreds-of-newborns-genomes.html">http://blogs.nature.com/news/2013/09/scientists-to-sequence-hundreds-of-newborns-genomes.html</a></p><p><a href="http://www.genome.gov/27554919">http://www.genome.gov/27554919</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33976/goldgenomes-online-database</guid>
	<pubDate>Wed, 26 Jul 2017 07:49:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33976/goldgenomes-online-database</link>
	<title><![CDATA[GOLD:Genomes Online Database]]></title>
	<description><![CDATA[<p><span>GOLD</span><span>:Genomes Online Database, is a World Wide Web resource for comprehensive access to information regarding genome and metagenome sequencing projects, and their associated metadata, around the world.</span></p>
<p>https://gold.jgi.doe.gov/</p><p>Address of the bookmark: <a href="https://gold.jgi.doe.gov/" rel="nofollow">https://gold.jgi.doe.gov/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34413/coursera-genome-assembly-tutorial</guid>
	<pubDate>Sat, 25 Nov 2017 08:57:25 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34413/coursera-genome-assembly-tutorial</link>
	<title><![CDATA[coursera genome assembly tutorial]]></title>
	<description><![CDATA[<p><span>Solutions to Coursera Genome Sequencing (Bioinformatics II)</span></p><p>Address of the bookmark: <a href="https://github.com/iansealy/coursera-assembly" rel="nofollow">https://github.com/iansealy/coursera-assembly</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34519/bandage-interactive-visualization-of-de-novo-genome-assemblies</guid>
	<pubDate>Mon, 04 Dec 2017 10:09:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34519/bandage-interactive-visualization-of-de-novo-genome-assemblies</link>
	<title><![CDATA[Bandage: interactive visualization of de novo genome assemblies]]></title>
	<description><![CDATA[<p>Bandage (a Bioinformatics Application for Navigating&nbsp;<em>De&nbsp;novo</em>&nbsp;Assembly Graphs Easily) is a tool for visualizing assembly graphs with connections. Users can zoom in to specific areas of the graph and interact with it by moving nodes, adding labels, changing colors and extracting sequences. BLAST searches can be performed within the Bandage graphical user interface and the hits are displayed as highlights in the graph. By displaying connections between contigs, Bandage presents new possibilities for analyzing&nbsp;<em>de novo</em>&nbsp;assemblies that are not possible through investigation of contigs alone.</p>
<p><strong>Availability and implementation:</strong>&nbsp;Source code and binaries are freely available at&nbsp;<a href="https://github.com/rrwick/Bandage" target="pmc_ext">https://github.com/rrwick/Bandage</a>. Bandage is implemented in C++ and supported on Linux, OS X and Windows. A full feature list and screenshots are available at&nbsp;<a href="http://rrwick.github.io/Bandage" target="pmc_ext">http://rrwick.github.io/Bandage</a>.</p><p>Address of the bookmark: <a href="http://rrwick.github.io/Bandage/" rel="nofollow">http://rrwick.github.io/Bandage/</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34715/delta-a-new-web-based-3d-genome-visualization-and-analysis-platform</guid>
	<pubDate>Wed, 20 Dec 2017 08:49:55 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34715/delta-a-new-web-based-3d-genome-visualization-and-analysis-platform</link>
	<title><![CDATA[Delta: a new Web-based 3D genome visualization and analysis platform]]></title>
	<description><![CDATA[<p><em>Delta</em><span>&nbsp;is an integrative visualization and analysis platform to facilitate visually annotating and exploring the 3D physical architecture of genomes.&nbsp;</span><em>Delta</em><span>&nbsp;takes Hi-C or ChIA-PET contact matrix as input and predicts the topologically associating domains and chromatin loops in the genome. It then generates a physical 3D model which represents the plausible consensus 3D structure of the genome.&nbsp;</span><em>Delta</em><span>features a highly interactive visualization tool which enhances the integration of genome topology/physical structure with extensive genome annotation by juxtaposing the 3D model with diverse genomic assay outputs.</span></p>
<p>https://github.com/zhangzhwlab/delta</p><p>Address of the bookmark: <a href="https://github.com/zhangzhwlab/delta" rel="nofollow">https://github.com/zhangzhwlab/delta</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35883/arcs-scaffolding-genome-drafts-with-linked-reads</guid>
	<pubDate>Tue, 06 Mar 2018 16:35:26 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35883/arcs-scaffolding-genome-drafts-with-linked-reads</link>
	<title><![CDATA[ARCS: scaffolding genome drafts with linked reads]]></title>
	<description><![CDATA[<p><span>ARCS, an application that utilizes the barcoding information contained in linked reads to further organize draft genomes into highly contiguous assemblies. We show how the contiguity of an ABySS&nbsp;</span><em>H.sapiens</em><span>genome assembly can be increased over six-fold, using moderate coverage (25-fold) Chromium data. We expect ARCS to have broad utility in harnessing the barcoding information contained in linked read data for connecting high-quality sequences in genome assembly drafts.</span></p><p>Address of the bookmark: <a href="https://github.com/bcgsc/ARCS/" rel="nofollow">https://github.com/bcgsc/ARCS/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</guid>
	<pubDate>Tue, 15 May 2018 09:42:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</link>
	<title><![CDATA[Circlator: automated circularization of genome assemblies using long sequencing reads]]></title>
	<description><![CDATA[A tool to circularize genome assemblies. The algorithm and benchmarks are described in the Genome Biology manuscript. 

Citation: "Circlator: automated circularization of genome assemblies using long sequencing reads", Hunt et al, Genome Biology 2015 Dec 29;16(1):294. doi: 10.1186/s13059-015-0849-0. PMID: 26714481.<p>Address of the bookmark: <a href="http://sanger-pathogens.github.io/circlator/" rel="nofollow">http://sanger-pathogens.github.io/circlator/</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>