<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43799?offset=300</link>
	<atom:link href="https://bioinformaticsonline.com/related/43799?offset=300" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33960/mgra-breakpoint-graphs-and-ancestral-genome-reconstructions</guid>
	<pubDate>Tue, 25 Jul 2017 08:48:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33960/mgra-breakpoint-graphs-and-ancestral-genome-reconstructions</link>
	<title><![CDATA[MGRA: Breakpoint graphs and ancestral genome reconstructions]]></title>
	<description><![CDATA[<p>MGRA (Multiple Genome Rearrangements and Ancestors) is a tool for reconstruction of ancestor genomes and evolutionary history of extant genomes.</p>
<p>It takes as an input a set of genomes represented as sequences of genes (or synteny blocks) and produces such sequences for ancestral genomes at the internal nodes of the phylogenetic tree.</p>
<p>The phylogenetic tree may be also specified completely or partially, in the latter case MGRA can reconstruct conserved ancestral regions (CARs) of the ancestral genome of interest.</p>
<p>Since version 2 MGRA supports gene insertion and deletions in addition to genome rearrangements and allows the input genomes to have different gene content.</p>
<p>It also can reconstruct most plausible phylogenetic tree based on the rearrangement characters.</p><p>Address of the bookmark: <a href="http://mgra.cblab.org/" rel="nofollow">http://mgra.cblab.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34377/genomicus-genome-browser-that-enables-users-to-navigate-in-genomes-in-several-dimensions</guid>
	<pubDate>Sat, 18 Nov 2017 16:10:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34377/genomicus-genome-browser-that-enables-users-to-navigate-in-genomes-in-several-dimensions</link>
	<title><![CDATA[Genomicus: genome browser that enables users to navigate in genomes in several dimensions]]></title>
	<description><![CDATA[<p>Genomicus is a genome browser that enables users to navigate in genomes in several dimensions: linearly along chromosome axes, transversaly across different species, and chronologicaly along evolutionary time.</p>
<p>Once a query gene has been entered, it is displayed in its genomic context in parallel to the genomic context of all its orthologous and paralogous copies in all the other sequenced metazoan genomes. Moreover, Genomicus stores and displays the predicted ancestral genome structure in all the ancestral species within the phylogenetic range of interest.</p>
<p>All the data on extant species displayed in this browser are from&nbsp;<a href="http://www.ensembl.org/">Ensembl</a>.</p><p>Address of the bookmark: <a href="http://genomicus.biologie.ens.fr/genomicus-90.01/cgi-bin/search.pl" rel="nofollow">http://genomicus.biologie.ens.fr/genomicus-90.01/cgi-bin/search.pl</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34488/scripts-for-the-analysis-of-hgt-in-genome-sequence-data</guid>
	<pubDate>Wed, 29 Nov 2017 16:44:10 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34488/scripts-for-the-analysis-of-hgt-in-genome-sequence-data</link>
	<title><![CDATA[Scripts for the analysis of HGT in genome sequence data.]]></title>
	<description><![CDATA[<p><span>Scripts for the analysis of HGT in genome sequence data</span></p><p>Address of the bookmark: <a href="https://github.com/reubwn/hgt" rel="nofollow">https://github.com/reubwn/hgt</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34685/tools-for-bacterial-whole-genome-annotation</guid>
	<pubDate>Sat, 16 Dec 2017 17:37:47 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34685/tools-for-bacterial-whole-genome-annotation</link>
	<title><![CDATA[Tools for bacterial whole genome annotation]]></title>
	<description><![CDATA[<p><a href="http://rast.nmpdr.org/">RAST</a>&nbsp;&ndash;&nbsp;Web tool (upload contigs), uses the subsystems in the SEED database and&nbsp;provides detailed annotation and pathway analysis. Takes several hours per genome but I think this is the best way to get a high quality annotation (if you have only a few genomes to annotate).</p><p><a href="http://www.vicbioinformatics.com/software.prokka.shtml">Prokka</a>&nbsp;&ndash;&nbsp;Standalone command line tool, takes just a few minutes per genome.&nbsp;This is the best way to get good quality annotation in a flash, which is particularly useful if you have loads of genomes or need to annotate a pangenome or metagenome. Note however that the quality of functional information is not as good as RAST, and you&nbsp;will need several extra steps if you want to do&nbsp;functional profiling and pathway analysis of your genome(s)&hellip; which is in-built in RAST.</p><p>NCBI Prokaryotic Genome Annotation Pipeline is designed to annotate bacterial and archaeal genomes (chromosomes and plasmids).</p><p>Genome annotation is a multi-level process that includes prediction of protein-coding genes, as well as other functional genome units such as structural RNAs, tRNAs, small RNAs, pseudogenes, control regions, direct and inverted repeats, insertion sequences, transposons and other mobile elements.</p><p><a href="https://www.ncbi.nlm.nih.gov/genome/annotation_prok/">PGAP</a>: NCBI has developed an automatic prokaryotic genome annotation pipeline that combines&nbsp;<em>ab initio</em>&nbsp;gene prediction algorithms with homology based methods. The first version of NCBI Prokaryotic Genome Automatic Annotation Pipeline (PGAAP;&nbsp;<a href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=pubmed&amp;dopt=Abstract&amp;list_uids=18416670">see Pubmed Article</a>) developed in 2005 has been replaced with an upgraded version that is capable of processing a larger data volume.&nbsp; NCBI's annotation pipeline depends on several internal databases and is not currently available for download or use outside of the NCBI environment.</p><p><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC453985">BEACON</a> (automated tool for Bacterial GEnome Annotation ComparisON), a fast tool for an automated and a systematic comparison of different annotations of single genomes. The extended annotation assigns putative functions to many genes with unknown functions. BEACON is available under GNU General Public License version 3.0 and is accessible at:&nbsp;<a href="http://www.cbrc.kaust.edu.sa/BEACON/" target="pmc_ext">http://www.cbrc.kaust.edu.sa/BEACON/</a>.</p><p><a href="http://www.kegg.jp/blastkoala/">BlastKOLA</a>: Assigns K numbers to the user's sequence data by BLAST searches, respectively, against a nonredundant set of KEGG GENES. KOALA (KEGG Orthology And Links Annotation) is KEGG's internal annotation tool for K number assignment of KEGG GENES using SSEARCH computation. Annotate Sequence in KEGG Mapper and Pathogen Checker in KEGG Pathogen are special interfaces to this server and can be executed in an interactive mode. BlastKOALA is suitable for annotating fully sequenced genomes.</p><p><a href="http://www.sanger.ac.uk/science/tools/pagit">PAGIT</a>: Provides a toolkit for improving the quality of genome assemblies created via an assembly software. PAGIT compiled four tools: (i) ABACAS which classifies and orientates contigs and estimates the sizes of gaps between them; (ii) IMAGE uses paired-end reads to extend contigs and close gaps within the scaffolds; (iii) ICORN for identifying and correcting small errors in consensus sequences and; (iv) RATT for help annotation. The software was mainly created to analyze parasite genomes of up to about 300 Mb.</p><p><a href="http://www.yandell-lab.org/software/maker.html">MAKER: </a>A portable and easily configurable genome annotation pipeline. MAKER allows smaller eukaryotic and prokaryotic genome projects to independently annotate their genomes and to create genome databases. It identifies repeats, aligns ESTs and proteins to a genome, produces ab-initio gene predictions and automatically synthesizes these data into gene annotations having evidence-based quality values. MAKER's inputs are minimal and its ouputs can be directly loaded into a Generic Model Organism Database (GMOD). They can also be viewed in the Apollo genome browser; this feature of MAKER provides an easy means to annotate, view and edit individual contigs and BACs without the overhead of a database. MAKER is available for download and can be tested online via the MAKER Web Annotation Service (MWAS).</p><p><a href="https://www.sciencedirect.com/science/article/pii/S0167701215001207">MyPro</a> is a software pipeline for high-quality prokaryotic genome assembly and annotation. It was validated on 18 oral streptococcal strains to produce submission-ready, annotated draft genomes. MyPro installed as a virtual machine and supported by updated databases will enable biologists to perform quality prokaryotic genome assembly and annotation with ease.</p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</guid>
	<pubDate>Tue, 26 Dec 2017 22:23:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</link>
	<title><![CDATA[Magic-BLAST: a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome.]]></title>
	<description><![CDATA[<p>Magic-BLAST is a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome. Each alignment optimizes a composite score, taking into account simultaneously the two reads of a pair, and in case of RNA-seq, locating the candidate introns and adding up the score of all exons. This is very different from other versions of BLAST, where each exon is scored as a separate hit and read-pairing is ignored.</p>
<p>Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/26109056">(http://www.ncbi.nlm.nih.gov/pubmed/26109056)</a>, and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.</p><p>Address of the bookmark: <a href="https://ncbi.github.io/magicblast/" rel="nofollow">https://ncbi.github.io/magicblast/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35429/list-of-visualization-tools-for-genome-alignments</guid>
	<pubDate>Fri, 02 Feb 2018 13:25:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35429/list-of-visualization-tools-for-genome-alignments</link>
	<title><![CDATA[List of visualization tools for genome alignments]]></title>
	<description><![CDATA[<p><span>Genome</span><span>&nbsp;browsers are useful not only for showing final results but also for improving analysis protocols, testing data quality, and generating result drafts. Its integration in analysis pipelines allows the optimization of parameters, which leads to better results. But sometime, we need publication ready figure of genomes. Following are the list of genome alignment visualization tools, which could be useful for analysis and&nbsp;interpretation of results:</span></p><p>ABySS Explorer</p><p>Interactive Java application that uses a novel graph-based representation to display a sequence assembly and associated metadata</p><p>http://www.bcgsc.ca/platform/bioinfo/software/abyss-explorer</p><p>BamView</p><p>Genome browser and annotation tool that allows visualization of sequence features, next-generation sequencing (NGS) data and the results of analyses within the context of the sequence, and also its six-frame translation</p><p>http://www.sanger.ac.uk/resources/software/artemis/</p><p>DNannotator&nbsp;</p><p>Annotation web toolkit for regional genomic sequences</p><p>http://bioapp.psych.uic.edu/DNannotator.htm</p><p>JVM&nbsp;</p><p>Java Visual Mapping tool for NGS reads</p><p>http://www.springer.com/cda/content/document/cda_downloaddocument/9789401792448-c2.pdf?SGWID=0-0-45-1487072-p176815501</p><p>LookSeq&nbsp;</p><p>Web-based visualization of sequences derived from multiple sequencing technologies. Low- or high-depth read pileups and easy visualization of putative single nucleotide and structural variation</p><p>http://lookseq.sourceforge.net</p><p>MagicViewer&nbsp;</p><p>Visualization of short read alignment, identification of genetic variation and association with annotation information of a reference genome</p><p>http://bioinformatics.zj.cn/magicviewer/</p><p>MapView&nbsp;</p><p>Alignments of huge-scale single-end and pair-end short reads</p><p>http://omictools.com/mapview-s1367.html</p><p>MultiPipMaker</p><p>Computes alignments of similar regions in two DNA sequences. The resulting alignments are summarized with a &lsquo;percent identity plot&rsquo; (pip)</p><p>http://pipmaker.bx.psu.edu/pipmaker/</p><p>PileLineGUI&nbsp;</p><p>Handling genome position files in NGS studies</p><p>http://sing.ei.uvigo.es/pileline/pilelinegui.html</p><p>SAMtools tview&nbsp;</p><p>Simple and fast text alignment viewer; NGS compatible</p><p>http://www.htslib.org/</p><p>SEWAL</p><p>Uses a locality-sensitive hashing algorithm to enumerate all unique sequences in an entire Illumina sequencing run</p><p>http://www.sourceforge.net/projects/sewal</p><p>STAR&nbsp;</p><p>A web-based integrated solution to management and visualization of sequencing data</p><p>http://wanglab.ucsd.edu/star/browser</p><p>SVA&nbsp;</p><p>Software for annotating and visualizing sequenced human genomes</p><p>http://www.svaproject.org</p><p>Viewer (IGV)&nbsp;</p><p>Visualization of large heterogeneous datasets, providing a smooth and intuitive user experience at all levels of genome resolution</p><p>https://www.broadinstitute.org/igv/</p><p>ZOOM Lite&nbsp;</p><p>NGS data mapping and visualization software</p><p>http://bioinfor.com/zoom/lite/</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</guid>
	<pubDate>Thu, 12 Apr 2018 10:00:27 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36218/g-compass-a-comparative-genome-browser</link>
	<title><![CDATA[G-compass: a comparative genome browser]]></title>
	<description><![CDATA[<p><span>G-compass (</span><a href="http://www.h-invitational.jp/g-compass/" target="_top">http://www.h-invitational.jp/g-compass/</a><span>) is a comparative genome browser. It visualizes evolutionarily conserved genomic regions between human and other 12 vertebrates based on original genome alignments pursuing higher coverage (1,2). Annotations of human genes/transcripts and their ortholog information were derived from&nbsp;</span><a href="http://www.h-invitational.jp/hinv/ahg-db/index.jsp" target="_top">H-InvDB</a><span>&nbsp;and its subdatabase&nbsp;</span><a href="http://www.h-invitational.jp/evola/" target="_top">Evola</a><span>, respectively. G-compass is available for free of charge. [&nbsp;</span><a href="http://www.h-invitational.jp/g-compass/cgi-bin/gc_main.cgi?species_1=Hg18&amp;species_2=pt2&amp;strand_1=%2B&amp;strand_2=%2B&amp;from_win=main&amp;gen_str=2&amp;chr_1=01&amp;chr_2=01&amp;st_1=103804298&amp;ed_1=104204297&amp;st_2=105235351&amp;ed_2=105635350" target="_top">Sample</a><span>&nbsp;]</span></p><p>Address of the bookmark: <a href="http://www.h-invitational.jp/g-compass/" rel="nofollow">http://www.h-invitational.jp/g-compass/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</guid>
	<pubDate>Tue, 15 May 2018 09:42:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</link>
	<title><![CDATA[Circlator: automated circularization of genome assemblies using long sequencing reads]]></title>
	<description><![CDATA[A tool to circularize genome assemblies. The algorithm and benchmarks are described in the Genome Biology manuscript. 

Citation: "Circlator: automated circularization of genome assemblies using long sequencing reads", Hunt et al, Genome Biology 2015 Dec 29;16(1):294. doi: 10.1186/s13059-015-0849-0. PMID: 26714481.<p>Address of the bookmark: <a href="http://sanger-pathogens.github.io/circlator/" rel="nofollow">http://sanger-pathogens.github.io/circlator/</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</guid>
	<pubDate>Mon, 11 Jun 2018 03:08:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36890/price-paired-read-iterative-contig-extension-a-de-novo-genome-assembler-implemented-in-c</link>
	<title><![CDATA[PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++.]]></title>
	<description><![CDATA[We are pleased to release PRICE (Paired-Read Iterative Contig Extension), a de novo genome assembler implemented in C++. Its name describes the strategy that it implements for genome assembly: PRICE uses paired-read information to iteratively increase the size of existing contigs. Initially, those contigs can be individual reads from a subset of the paired-read dataset, non-paired reads from sequencing technologies that provide non-paired data, or contigs that were output from a prior run of PRICE or any other assembler.

http://derisilab.ucsf.edu/software/price/<p>Address of the bookmark: <a href="http://derisilab.ucsf.edu/software/price/" rel="nofollow">http://derisilab.ucsf.edu/software/price/</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>