BOL: Related items

REVIGO: Reduced Visualize gene ontology

Jit — Tue, 31 Jul 2018 05:28:42 -0500

REViGO can take long lists of Gene Ontology terms and summarize them by removing redundant GO terms. The remaining terms can be visualized in semantic similarity-based scatterplots, interactive graphs, or tag clouds. More about REViGO... |

Please enter a list of Gene Ontology IDs below, each on its own line. The GO IDs may be followed by p-values or another quantity which describes the GO term in a way meaningful to you.

Address of the bookmark: http://revigo.irb.hr/

GeneMates: an R package for Detecting Horizontal Gene Co-transfer between Bacteria Using Gene-gene Associations Controlled for Population Structure

Rahul Nayak — Sat, 07 Mar 2020 05:52:20 -0600

GeneMates is an R package implementing a network approach to identify horizontal gene co-transfer (HGcoT) between bacteria using whole-genome sequencing (WGS) data. It is particularly useful for investigating intra-species HGcoT, where presence-absence status of acquired genes is usually confounded by bacterial population structure due to clonal reproduction.

https://www.biorxiv.org/content/10.1101/2020.02.29.970970v1

Address of the bookmark: https://github.com/wanyuac/GeneMates

G-NEST: The Gene NEighborhood Scoring Tool

Neel — Fri, 25 Sep 2020 20:09:18 -0500

The Gene NEighborhood Scoring Tool (G-NEST) combines genomic location, gene expression, and evolutionary sequence conservation data to score putative gene neighborhoods across all window sizes. Primary author of final code = William F. Martin. Example data files are in the separate repository.

Address of the bookmark: https://github.com/dglemay/G-NEST

Tigers genome sequenced

Rahul Agarwal — Tue, 17 Sep 2013 16:48:24 -0500

Fifteen scientists led by Dr Jong Bhak of Genome Research Foundation, South Korea, decoded as many as 3 billion nucleotides (organic molecules that form the basic building blocks of nucleic acids, such as DNA). They identified 20,000 genes related to various functions of the tiger.

The biggest and perhaps most fearsome of the world's big cats, the tiger, shares 95.6 percent of its DNA with humans' cute and furry companions, domestic cats.

The new research showed that big cats have genetic mutations that enabled them to be carnivores. The team also identified mutations that allow snow leopards to thrive at high altitudes.

Reference:

http://www.nbcnews.com/science/your-cat-ferocious-tigers-share-lot-95-6-percent-their-4B11182690

http://timesofindia.indiatimes.com/home/environment/flora-fauna/Gene-mapping-of-tiger-completed/articleshow/22671681.cms

Paper:

http://www.nature.com/ncomms/2013/130917/ncomms3433/full/ncomms3433.html

EuGI: a novel resource for studying genomic islands to facilitate horizontal gene transfer detection in eukaryotes

Surabhi Chaudhary — Sat, 12 May 2018 07:26:59 -0500

SWGIS v2.0 along with the EuGI database, which houses GIs identified in 66 different eukaryotic species, and the EuGI web-resource, provide the first comprehensive resource for studying HGT in eukaryotes.

https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-018-4724-8

Address of the bookmark: https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-018-4724-8

EGAD: Ultra-fast functional analysis of gene networks

Rahul Nayak — Fri, 14 Dec 2018 04:10:35 -0600

With the EGAD (Extending ‘Guilt-by-Association’ by Degree) package, we present a series of highly efficient tools to calculate functional properties in networks based on the guilt-by-association principle. These allow rapid controlled comparisons and analyses. Two of the core features are: a function prediction algorithm which is fully vectorized (neighbor_voting), allowing network characterization across even thousands of functional groups to be accomplished in minutes in cross-validation and an analytic determination of the optimal prior to guess candidates genes across multiple functional sets (calculate_multifunc, auc_multifunc).

Address of the bookmark: https://github.com/sarbal/EGAD

gggenes: a ggplot2 extension for drawing gene arrow maps.

BioStar — Tue, 02 Jun 2020 11:43:34 -0500

Install the stable version of gggenes from CRAN:

install.packages("gggenes")

If you want the development version, install it from GitHub:

devtools::install_github("wilkox/gggenes")

More at https://github.com/wilkox/gggenes

Address of the bookmark: http://wilkox.org/gggenes

MetaEuk - sensitive, high-throughput gene discovery and annotation for large-scale eukaryotic metagenomics

Jit — Wed, 13 Jan 2021 19:29:32 -0600

MetaEuk is a modular toolkit designed for large-scale gene discovery and annotation in eukaryotic metagenomic contigs. Metaeuk combines the fast and sensitive homology search capabilities of MMseqs2 with a dynamic programming procedure to recover optimal exons sets. It reduces redundancies in multiple discoveries of the same gene and resolves conflicting gene predictions on the same strand. MetaEuk is GPL-licensed open source software that is implemented in C++ and available for Linux and macOS. The software is designed to run on multiple cores.

Address of the bookmark: https://github.com/soedinglab/metaeuk

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data

Jit — Mon, 19 Feb 2018 06:46:15 -0600

ETE v3, featuring numerous improvements in the underlying library of methods, and providing a novel set of standalone tools to perform common tasks in comparative genomics and phylogenetics.

The new features include

(i) building gene-based and supermatrix-based phylogenies using a single command,

(ii) testing and visualizing evolutionary models,

(iii) calculating distances between trees of different size or including duplications, and

(iv) providing seamless integration with the NCBI taxonomy database.

ETE is freely available at http://etetoolkit.org

Address of the bookmark: http://etetoolkit.org