BOL: Related items

gggenes: a ggplot2 extension for drawing gene arrow maps.

BioStar — Tue, 02 Jun 2020 11:43:34 -0500

Install the stable version of gggenes from CRAN:

install.packages("gggenes")

If you want the development version, install it from GitHub:

devtools::install_github("wilkox/gggenes")

More at https://github.com/wilkox/gggenes

Address of the bookmark: http://wilkox.org/gggenes

MetaEuk - sensitive, high-throughput gene discovery and annotation for large-scale eukaryotic metagenomics

Jit — Wed, 13 Jan 2021 19:29:32 -0600

MetaEuk is a modular toolkit designed for large-scale gene discovery and annotation in eukaryotic metagenomic contigs. Metaeuk combines the fast and sensitive homology search capabilities of MMseqs2 with a dynamic programming procedure to recover optimal exons sets. It reduces redundancies in multiple discoveries of the same gene and resolves conflicting gene predictions on the same strand. MetaEuk is GPL-licensed open source software that is implemented in C++ and available for Linux and macOS. The software is designed to run on multiple cores.

Address of the bookmark: https://github.com/soedinglab/metaeuk

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data

Jit — Mon, 19 Feb 2018 06:46:15 -0600

ETE v3, featuring numerous improvements in the underlying library of methods, and providing a novel set of standalone tools to perform common tasks in comparative genomics and phylogenetics.

The new features include

(i) building gene-based and supermatrix-based phylogenies using a single command,

(ii) testing and visualizing evolutionary models,

(iii) calculating distances between trees of different size or including duplications, and

(iv) providing seamless integration with the NCBI taxonomy database.

ETE is freely available at http://etetoolkit.org

Address of the bookmark: http://etetoolkit.org

UnCoVar: Workflow for Transparent and Robust Virus Variant Calling, Genome Reconstruction and Lineage Assignment

BioStar — Mon, 05 Aug 2024 23:01:29 -0500

UnCoVar: Workflow for Transparent and Robust Virus Variant Calling, Genome Reconstruction and Lineage Assignment

Using state of the art tools, easily extended for other viruses
Tool and database updates for critical components via Conda
Built using modern design patterns with Conda and Snakemake
Extensible and easy to customize
Submission Ready Genomes
Customizable reporting with comprehensive visualization

https://ikim-essen.github.io/uncovar/

Github https://github.com/IKIM-Essen/uncovar

Address of the bookmark: https://ikim-essen.github.io/uncovar/

pipesnake: bioinformatics best-practice analysis pipeline for phylogenomic reconstruction

LEGE — Wed, 21 Feb 2024 06:19:41 -0600

ausarg/pipesnake is a bioinformatics best-practice analysis pipeline for phylogenomic reconstruction starting from short-read 'second-generation' sequencing data.

The pipeline is built using Nextflow, a workflow tool to run tasks across multiple compute infrastructures in a very portable manner. It uses Docker/Singularity containers making installation trivial and results highly reproducible. The Nextflow DSL2 implementation of this pipeline uses one container per process which makes it much easier to maintain and update software dependencies.

Address of the bookmark: https://github.com/AusARG/pipesnake