<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43846?offset=400</link>
	<atom:link href="https://bioinformaticsonline.com/related/43846?offset=400" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</guid>
	<pubDate>Thu, 04 Oct 2018 17:23:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</link>
	<title><![CDATA[Long read assembly workshop !]]></title>
	<description><![CDATA[<p>This is a tutorial for a workshop on long-read (PacBio) genome assembly.</p>
<p>It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.</p>
<p>&nbsp;Please comment if you know any other long read addembly tutorial.</p><p>Address of the bookmark: <a href="http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/" rel="nofollow">http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</guid>
	<pubDate>Tue, 30 Oct 2018 10:49:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38041/synima-a-synteny-imaging-tool-for-annotated-genome-assemblies</link>
	<title><![CDATA[Synima: a Synteny imaging tool for annotated genome assemblies]]></title>
	<description><![CDATA[<p><span>Synima written in Perl, which uses the graphical features of R. Synima takes orthologues computed from reciprocal best BLAST hits or OrthoMCL, and DAGchainer, and outputs an overview of genome-wide synteny in PDF. Each of these programs are included with the Synima package, and a pipeline for their use. Synima has a range of graphical parameters including size, colours, order, and labels, which are specified in a config file generated by the first run of Synima &ndash; and can be subsequently edited. Synima runs quickly on a command line to generate informative and publication quality figures. Synima is open source and freely available from&nbsp;</span><a href="https://github.com/rhysf/Synima" target="_blank">https://github.com/rhysf/Synima</a><span>&nbsp;under the MIT License.</span></p><p>Address of the bookmark: <a href="https://github.com/rhysf/Synima" rel="nofollow">https://github.com/rhysf/Synima</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38208/anitools-web-a-web-tool-for-fast-genome-comparison-within-multiple-bacterial-strains</guid>
	<pubDate>Wed, 14 Nov 2018 04:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38208/anitools-web-a-web-tool-for-fast-genome-comparison-within-multiple-bacterial-strains</link>
	<title><![CDATA[ANItools web: a web tool for fast genome comparison within multiple bacterial strains]]></title>
	<description><![CDATA[<p><span>ANItools is a software package written by PERL scripts that can be run in a Linux/Unix system. If you want to compare bacterial genomes and calculate their average nucleotide identity (ANI), you could download and run this program directly. Or you could send us the genome sequence by email. Then we will do the analysis work for you.</span></p>
<p><span>https://academic.oup.com/database/article/doi/10.1093/database/baw084/2630454</span></p><p>Address of the bookmark: <a href="http://ani.mypathogen.cn/" rel="nofollow">http://ani.mypathogen.cn/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38413/genobuntu-a-software-package-containing-more-than-70-software-and-packages-oriented-towards-ngs-and-genome-assembly</guid>
	<pubDate>Tue, 11 Dec 2018 05:15:57 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38413/genobuntu-a-software-package-containing-more-than-70-software-and-packages-oriented-towards-ngs-and-genome-assembly</link>
	<title><![CDATA[Genobuntu: A software package containing more than 70 software and packages oriented towards NGS and genome assembly]]></title>
	<description><![CDATA[<p><span>Genobuntu is a software package containing more than 70 software and packages oriented towards NGS. In its current version, Genobuntu supports pre assembly tools, genome assemblers as well as post assembly tools.&nbsp;</span><br><br><span>Commonly used biological software and example script files for different assembly pipelines have also been provided, where the example script files can be updated to suit one&rsquo;s experimental needs. Genobuntu attempts to reduce the amount of time and energy needed to build software workstations and it can also act as a good teaching source for a class room setting.&nbsp;</span></p>
<p>https://sourceforge.net/projects/genobuntu/</p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/genobuntu/" rel="nofollow">https://sourceforge.net/projects/genobuntu/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38526/versatile-genome-assembly-evaluation-with-quast-lg</guid>
	<pubDate>Fri, 21 Dec 2018 22:06:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38526/versatile-genome-assembly-evaluation-with-quast-lg</link>
	<title><![CDATA[Versatile genome assembly evaluation with QUAST-LG]]></title>
	<description><![CDATA[<p>QUAST-LG is an extension of&nbsp;<a href="http://cab.spbu.ru/software/quast/">QUAST</a>&nbsp;intended for evaluating large-scale genome assemblies (up to mammalian-size).</p>
<p>QUAST-LG&nbsp;is included in the QUAST&nbsp; package starting from version 5.0.0 (<a href="https://sourceforge.net/projects/quast/files/latest/download?source=files">download the latest release</a>). Run QUAST as usual and do not forget to add&nbsp;<span>‐‐large</span>&nbsp;option to your command!</p>
<p>A short list of the new features (see&nbsp;<a href="http://cab.spbu.ru/files/quast/latest-docs/CHANGES.txt">CHANGES</a>&nbsp;for all):</p>
<ul>
<li>Significant speedup achieved by both&nbsp;use of new fast aligner (<a href="https://github.com/lh3/minimap2">minimap2</a>) and the refactoring of alignment analyzing&nbsp;modules</li>
<li>New k-mer-based completeness and correctness metrics</li>
<li>BUSCO added for enhanced reference-free analysis</li>
<li>The concept of upper bound&nbsp;assembly (theoretical limits on the assembly&nbsp;completeness and&nbsp;contiguity for a given genome and set of reads)</li>
</ul><p>Address of the bookmark: <a href="http://cab.spbu.ru/software/quast-lg/" rel="nofollow">http://cab.spbu.ru/software/quast-lg/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38670/ltr-finder-an-efficient-program-for-finding-full-length-ltr-retrotranspsons-in-genome-sequences</guid>
	<pubDate>Sun, 13 Jan 2019 07:05:53 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38670/ltr-finder-an-efficient-program-for-finding-full-length-ltr-retrotranspsons-in-genome-sequences</link>
	<title><![CDATA[LTR_Finder: an efficient program for finding full-length LTR retrotranspsons in genome sequences.]]></title>
	<description><![CDATA[<p>LTR_Finder is an efficient program for finding full-length LTR retrotranspsons in genome sequences.</p>
<p>The Program first constructs all exact match pairs by a suffix-array based algorithm and extends them to long highly similar pairs. Then Smith-Waterman algorithm is used to adjust the ends of LTR pair candidates to get alignment boundaries. These boundaries are subject to re-adjustment using supporting information of TG..CA box and TSRs and reliable LTRs are selected. Next, LTR_FINDER tries to identify PBS, PPT and RT inside LTR pairs by build-in aligning and counting modules. RT identification includes a dynamic programming to process frame shift. For other protein domains, LTR_FINDER calls ps_scan (from PROSITE,&nbsp;<a href="http://www.expasy.org/prosite/">http://www.expasy.org/prosite/</a>) to locate cores of important enzymes if they occur.</p><p>Address of the bookmark: <a href="https://github.com/xzhub/LTR_Finder" rel="nofollow">https://github.com/xzhub/LTR_Finder</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>