BOL: Related items

RefKA: A fast and efficient long-read genome assembly approach for large and complex genomes

Rahul Nayak — Fri, 01 May 2020 03:00:40 -0500

RefKA, a reference-based approach for long read genome assembly. This approach relies on breaking up a closely related reference genome into bins, aligning k-mers unique to each bin with PacBio reads, and then assembling each bin in parallel followed by a final bin-stitching step.

Address of the bookmark: https://github.com/AppliedBioinformatics/RefKA

minialign: fast and accurate alignment tool for PacBio and Nanopore long reads

Jit — Thu, 24 May 2018 08:33:26 -0500

Minialign is a little bit fast and moderately accurate nucleotide sequence alignment tool designed for PacBio and Nanopore long reads. It is built on three key algorithms, minimizer-based index of the minimap overlapper, array-based seed chaining, and SIMD-parallel Smith-Waterman-Gotoh extension.

Address of the bookmark: https://github.com/ocxtal/minialign

Flye: Fast and accurate de novo assembler for single molecule sequencing reads

BioJoker — Tue, 02 Apr 2019 21:54:55 -0500

Flye is a de novo assembler for single molecule sequencing reads, such as those produced by PacBio and Oxford Nanopore Technologies. It is designed for a wide range of datasets, from small bacterial projects to large mammalian-scale assemblies. The package represents a complete pipeline: it takes raw PB / ONT reads as input and outputs polished contigs. Flye also includes a special mode for metagenome assembly.

Address of the bookmark: https://github.com/fenderglass/Flye

HiTE: a fast and accurate dynamic boundary adjustment approach for full-length Transposable Elements detection and annotation in Genome Assemblies

LEGE — Sat, 20 Sep 2025 09:34:04 -0500

HiTE is a Python software that uses a dynamic boundary adjustment approach to detect and annotate full-length Transposable Elements in Genome Assemblies. In comparison to other tools, HiTE demonstrates superior performance in detecting a greater number of full-length TEs.

panHiTE

We have developed panHiTE, a comprehensive and accurate pipeline for TE detection in large-scale population genomes. It has been successfully applied to hundreds of plant population genomes, demonstrating its effectiveness and scalability.

For detailed instructions, please refer to the panHiTE tutorial.

Address of the bookmark: https://github.com/CSU-KangHu/HiTE

SneakySnake: A Fast and Accurate Universal Genome Pre-Alignment Filter for CPUs, GPUs, and FPGAs

Neel — Sun, 20 Dec 2020 01:39:54 -0600

The first and the only pre-alignment filtering algorithm that works efficiently and fast on modern CPU, FPGA, and GPU architectures. SneakySnake greatly (by more than two orders of magnitude) expedites sequence alignment calculation for both short (Illumina) and long (ONT and PacBio) reads. Described by Alser et al. (preliminary version at https://arxiv.org/abs/1910.09020).

Address of the bookmark: https://github.com/CMU-SAFARI/SneakySnake

GraphMap - A highly sensitive and accurate mapper for long, error-prone reads

Jit — Wed, 07 Jun 2017 04:18:16 -0500

GraphMap - A highly sensitive and accurate mapper for long, error-prone reads http://www.nature.com/ncomms/2016/160415/ncomms11307/full/ncomms11307.html

Features

    Mapping position agnostic to alignment parameters.
    Consistently very high sensitivity and precision across different error profiles, rates and sequencing technologies even with default parameters.
    Circular genome handling to resolve coverage drops near ends of the genome.
    E-value.
    Meaningful mapping quality.
    Various alignment strategies (semiglobal bit-vector and Gotoh, anchored).
    Overlapping of reads for de novo assembly.
    Transcriptome mapping through internal construction of a transcriptome from a given genomic reference and a GTF file.
    ...and much more.

GraphMap is also used as an overlapper in a new de novo genome assembly project called Ra (https://github.com/mariokostelac/ra-integrate).
Ra attempts to create de novo assemblies from raw nanopore and PacBio reads without requiring error correction, for which a highly sensitive overlapper is required.

Currently, development of a new spliced-alignment mode for mapping RNA-seq reads is under way.
Description of the current effort as well as how to reach the experimental implementation can be found here: doc/rnaseq.md.

Address of the bookmark: https://github.com/isovic/graphmap

ACANA: An accurate and consistent alignment tool for DNA sequences

Jit — Wed, 06 Dec 2017 09:45:29 -0600

ACANA is an accurate and consistent alignment tool for DNA sequences. ACANA is specifically designed for aligning sequences that share only some moderately conserved regions and/or have a high frequency of long insertions or deletions. It attempts to combine the best of local and global alignments algorithms in searching for evolutionarily related regions of sequences in order to achieve the best alignment. ACANA is also robust to the small changes of alignment parameters, particularly the gap extension score. As an accurate alignment tool, ACANA is particularly useful in comparative sequence analysis for identifying conserved functional regulatory elements.

Address of the bookmark: https://www.niehs.nih.gov/research/resources/software/biostatistics/acana/index.cfm

OrthoGNC: A Software for Accurate Identification of Orthologs Based on Gene Neighborhood Conservation

Jit — Tue, 14 Nov 2017 09:30:35 -0600

Orthology relations can be used to transfer annotations from one gene (or protein) to another. Hence, detecting orthology relations has become an important task in the post-genomic era. Various genomic events, such as duplication and horizontal gene transfer, can cause erroneous assignment of orthology relations. In closely-related species, gene neighborhood information can be used to resolve many ambiguities in orthology inference. Here we present OrthoGNC, a software for accurately predicting pairwise orthology relations based on gene neighborhood conservation. Analyses on simulated and real data reveal the high accuracy of OrthoGNC. In addition to orthology detection, OrthoGNC can be employed to investigate the conservation of genomic context among potential orthologs detected by other methods. OrthoGNC is freely available online at http://bs.ipm.ir/softwares/orthognc and http://tinyurl.com/orthoGNC.

http://www.comp.nus.edu.sg/~wongls/projects/orthoGNC/

Address of the bookmark: http://www.sciencedirect.com/science/article/pii/S1672022917301663

JASMINE: Jointly Accurate Sv Merging with Intersample Network Edges

Shruti Paniwala — Sat, 02 Jul 2022 11:41:53 -0500

This tool is used to merge structural variants (SVs) across samples. Each sample has a number of SV calls, consisting of position information (chromosome, start, end, length), type and strand information, and a number of other values. Jasmine represents the set of all SVs across samples as a network, and uses a modified minimum spanning forest algorithm to determine the best way of merging the variants such that each merged variants represents a set of analogous variants occurring in different samples.

Address of the bookmark: https://github.com/mkirsche/Jasmine

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia