Address of the bookmark: https://github.com/legumeinfo/gcv

Features

• Circular and linear views of genomes

• Capable of drawing genomes up to 10 Mbp with 1000's of features and 100's contigs

• Smooth zooming down to the sequence level

• Easily generate features and plots directly form the sequence (e.g. ORFs, GC-content and GC-Skew)

• Save high resolution PNG maps up to 8000x8000px

• Fully documented API for interacting with CGView.js maps

Address of the bookmark: https://js.cgview.ca/

What Are lncRNAs?

lncRNAs are RNA transcripts longer than 200 nucleotides that do not code for proteins. Despite their non-coding nature, they play diverse roles in gene regulation, including chromatin remodeling, transcriptional control, and post-transcriptional processing. Unlike messenger RNAs (mRNAs), lncRNAs often function as scaffolds, decoys, or guides in cellular machinery, influencing biological processes such as cell differentiation, immune response, and even cancer metastasis.

Challenges in lncRNA Research

Identifying and understanding lncRNAs pose unique challenges:

1. High Sequence Variability: Unlike protein-coding genes, lncRNAs exhibit low sequence conservation across species, making functional predictions difficult.
2. Low Expression Levels: lncRNAs are often expressed at low levels, complicating their detection in transcriptomic data.
3. Diverse Functions: The multifunctional nature of lncRNAs requires advanced computational tools to decipher their roles in complex networks.

Bioinformatics: A Crucial Ally in lncRNA Research

Bioinformatics bridges the gap between raw biological data and meaningful insights, making it indispensable in lncRNA research. Here’s how:

1. Identification and Annotation

High-throughput sequencing technologies like RNA-seq generate vast amounts of data. Bioinformatics tools such as StringTie, Cufflinks, and HISAT2 help assemble and annotate lncRNAs from this data. Additionally, databases like NONCODE, LNCipedia, and Ensembl provide curated repositories of lncRNA sequences and annotations.

2. Functional Prediction

Bioinformatics algorithms predict the potential functions of lncRNAs by analyzing their interactions with DNA, RNA, and proteins. Tools like LncRNA2Function and RIblast utilize sequence motifs and secondary structure predictions to hypothesize about the roles of specific lncRNAs.

3. Network Construction

lncRNAs often act as regulatory hubs. Bioinformatics platforms such as Cytoscape enable the visualization of lncRNA-mediated networks, elucidating their roles in pathways like cell cycle regulation and apoptosis.

4. Epigenetic Studies

lncRNAs are known to interact with chromatin-modifying complexes, influencing gene expression epigenetically. Tools like ChIP-seq and ATAC-seq, combined with computational pipelines, identify these interactions and map them to the genome.

5. Clinical Applications

Bioinformatics aids in the discovery of lncRNA biomarkers for diseases like cancer and neurodegenerative disorders. Machine learning models analyze differential expression profiles, helping prioritize lncRNAs with therapeutic potential.

Case Study: lncRNAs in Cancer Research

lncRNAs such as HOTAIR and MALAT1 have been implicated in cancer progression. Bioinformatics analyses have revealed their roles in promoting metastasis and altering the tumor microenvironment. For example, transcriptome analysis in cancer patients identifies lncRNA expression signatures, enabling precision medicine approaches.

Future Directions

The fusion of bioinformatics with experimental biology is unlocking the secrets of lncRNAs. Advances in artificial intelligence, single-cell sequencing, and structural modeling promise to overcome current limitations. Here are some promising directions:

• Integrative Analysis: Combining multi-omics data to understand the interplay of lncRNAs with other biomolecules.
• CRISPR Screens: Leveraging bioinformatics to design CRISPR-based functional screens for lncRNAs.
• Therapeutic Development: Using bioinformatics to design lncRNA-based therapeutics, including antisense oligonucleotides and RNA interference tools.

Conclusion

lncRNAs are the hidden gems of the genome, and bioinformatics is the key to unearthing their full potential. As research progresses, lncRNAs could pave the way for novel diagnostics, targeted therapies, and personalized medicine, revolutionizing our approach to complex diseases.

The journey into the world of lncRNAs is only beginning, and bioinformatics will continue to play a pivotal role in decoding these molecular mysteries. Whether you’re a researcher, clinician, or bioinformatics enthusiast, the study of lncRNAs offers a fascinating frontier of discovery.

Overview of SLiM and msprime

SLiM: Forward Genetic Simulator

SLiM is a free, open-source tool designed for forward genetic simulations. It allows researchers to model complex evolutionary scenarios, including selection, recombination, and demographic events, making it particularly useful for studying adaptation and selection in populations.

Key Features of SLiM:

• Simulates population evolution forward in time

• Supports custom evolutionary models using an embedded scripting language

• Allows modeling of spatial and ecological dynamics

• Provides high flexibility and extensibility for user-defined scenarios

• Available on GitHub as an open-source project

msprime: Ancestry and Mutation Simulator

msprime is an efficient, open-source tool that simulates ancestry and mutations using a coalescent framework. It is known for its high-speed performance and low memory requirements, making it a popular choice for large-scale genomic simulations.

Key Features of msprime:

• Implements coalescent simulations for ancestry modeling

• Efficiently simulates large population histories

• Supports the addition of mutations to genealogies

• Developed using an open-source community model

• Often faster and more memory-efficient than alternative simulators

Using SLiM and msprime with slendr

Both SLiM and msprime can be integrated with slendr, a framework that facilitates structured population genetic simulations. This integration allows for seamless comparison of simulation outputs.

How They Work Together:

• SLiM and msprime simulations can be analyzed within slendr.

• The ts_read() function in slendr enables loading and comparing tree sequence outputs from both simulators.

• This integration allows researchers to validate simulation results and gain deeper insights into evolutionary processes.

Performance Considerations

While SLiM offers powerful forward simulations with extensive customization, msprime is often preferred for its speed and memory efficiency when simulating ancestry and mutations. The choice between the two depends on the research goals:

• For detailed evolutionary modeling with selection and recombination: Use SLiM.

• For large-scale coalescent simulations with mutations: Use msprime.

• For comparing different simulation models and their outputs: Use slendr to integrate SLiM and msprime results.

Conclusion

SLiM and msprime are valuable tools for genome simulation, each serving distinct but complementary purposes in population genetics research. By leveraging the strengths of both simulators with slendr, researchers can conduct robust and efficient evolutionary simulations, enhancing our understanding of genetic diversity and adaptation.

For more information, check out the official GitHub repositories for SLiM and msprime, and explore the slendr framework for streamlined simulation workflow

Position (scale), qualifications and experience

1. Information Officer (Rs 8000-275-13500): one post
Qualifications and experience: MCA, Post-Graduate in any field of biosciences, bioinformatics with at least two years of experience in working in a bioinformatics setup and good knowledge of linux operating system and computer networking.

General terms and conditions:
1. The above engagements is presently till March 31st, 2017. However on extension of project grant and satisfactory performance of the candidate, your services can be extended beyond March 31st, 2017 based on the terms and conditions of extension of project grant.

2. It is not an appointment with the institute and will not confer any right to the incumbent to any claim implicit or explicit on any position.

3.No TA/DA will be paid for attending the interview. Outstation candidates have to make their own arrangement for their stay.

4.Candidates, appearing in the walk-in interview are requested to bring the hard copy of application addressed to Dr. Anju Pappachan with latest photograph, CV mentioning qualifications, work experience and name of two referees and one page write up as to why you would like to join the project.

Address:
Dr. Anju Pappachan
Indian Institute of Advanced Research (IIAR),
University and Institute of Advanced Research,
The Puri Foundation for Education in India,
Koba Institutional Area,
Gandhinagar- 382 007, Gujarat, India. Contact no. 079-30514152
e-mail- anju@iiar.res.in

R script that makes a plotly interactive and/or static (png/pdf) dot plot.

Shiny app available for testing

Address of the bookmark: https://github.com/tpoorten/dotPlotly

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

More at http://cpansearch.perl.org/src/TJPARNELL/

Address of the bookmark: http://cpansearch.perl.org/src/TJPARNELL/

https://github.com/roblanf/minion_qc

Address of the bookmark: https://github.com/roblanf/minion_qc