Address of the bookmark: https://github.com/fenderglass/Flye

http://bioinfo.ut.ee/FastGT/

https://github.com/bioinfo-ut/GenomeTester4/

Address of the bookmark: http://bioinfo.ut.ee/FastGT/

Address of the bookmark: https://github.com/vpc-ccg/haslr

Smudgeplots are computed from raw or even better from trimmed reads and show the haplotype structure using heterozygous kmer pairs. For example:

Address of the bookmark: https://github.com/KamilSJaron/smudgeplot

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

In fact, there are huge demands for expert biological data analyst. It’s a fairly new  (not exactly) hot area, these bioinformatician are invaluable because they know and understand the significance of biological data for your research and how you can use it for better understanding of biological problems.

The bioinformatics can discover biological patterns and stories in genomic and proteomics data. They can develop the pipeline needed to properly collect, store and analyse it.

Once your research group is ready to make a larger investment and hire a bioinformatician to gain a competitive edge, there are several key traits to seek out in potential candidates. The best bioinformatician are:

1. Highly Skilled - programming skills, experience with the biological software and tools.

The biological data won’t illuminate much if the scientist analysing it doesn’t possess practical programming skills, experience with the biological software and tools and a thorough understanding of basic biological stuff. A solid background in mathematics and statistics is also an indispensable trait.

2. Insight - Real vision, robust understanding and deep insight.

In order to hire the best bioinformatics and computational biologist scientist for your needs, it is always recommended and mostly practiced by the recruiters, to ask each contender to write and develop a sample script/presentation based on a specific set of data you provide. Then, explore the approaches used to deal with data provided and pick up those candidates who convey real vision, robust understanding and deep insight.

3. Energetic – Curiosity to explore

Mostly natural curiosity and enthusiasm for solving big biological problems coupled with an ability to transform data into a scientific stories may place one candidate above the rest. In addition to achieve that, the bioinformatician should be agile enough to quickly modify their methods to suit changes within a particular research.

4. Researcher – Publications

Look for someone who has a keen sense and understanding of concern biological problems. You can judge it by looking at previously published papers and data. It is always recommended to have a look at GitHub and other repository for codes written by her/him.

5. Impressive communicator - Insight that can’t be expressed is worthless.

Good bioinformatics scientists are able to uncover biological patterns and are willing to explain those patterns in clear and helpful ways through thoughtful and open communication. In other words, they should must have good scientific writing skills. A computational biologis/bioinformatician  should know how to present the data and tell a scientific story through numbers/images.