Address of the bookmark: https://github.com/vpc-ccg/haslr

Smudgeplots are computed from raw or even better from trimmed reads and show the haplotype structure using heterozygous kmer pairs. For example:

Address of the bookmark: https://github.com/KamilSJaron/smudgeplot

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

In fact, there are huge demands for expert biological data analyst. It’s a fairly new  (not exactly) hot area, these bioinformatician are invaluable because they know and understand the significance of biological data for your research and how you can use it for better understanding of biological problems.

The bioinformatics can discover biological patterns and stories in genomic and proteomics data. They can develop the pipeline needed to properly collect, store and analyse it.

Once your research group is ready to make a larger investment and hire a bioinformatician to gain a competitive edge, there are several key traits to seek out in potential candidates. The best bioinformatician are:

1. Highly Skilled - programming skills, experience with the biological software and tools.

The biological data won’t illuminate much if the scientist analysing it doesn’t possess practical programming skills, experience with the biological software and tools and a thorough understanding of basic biological stuff. A solid background in mathematics and statistics is also an indispensable trait.

2. Insight - Real vision, robust understanding and deep insight.

In order to hire the best bioinformatics and computational biologist scientist for your needs, it is always recommended and mostly practiced by the recruiters, to ask each contender to write and develop a sample script/presentation based on a specific set of data you provide. Then, explore the approaches used to deal with data provided and pick up those candidates who convey real vision, robust understanding and deep insight.

3. Energetic – Curiosity to explore

Mostly natural curiosity and enthusiasm for solving big biological problems coupled with an ability to transform data into a scientific stories may place one candidate above the rest. In addition to achieve that, the bioinformatician should be agile enough to quickly modify their methods to suit changes within a particular research.

4. Researcher – Publications

Look for someone who has a keen sense and understanding of concern biological problems. You can judge it by looking at previously published papers and data. It is always recommended to have a look at GitHub and other repository for codes written by her/him.

5. Impressive communicator - Insight that can’t be expressed is worthless.

Good bioinformatics scientists are able to uncover biological patterns and are willing to explain those patterns in clear and helpful ways through thoughtful and open communication. In other words, they should must have good scientific writing skills. A computational biologis/bioinformatician  should know how to present the data and tell a scientific story through numbers/images.

Under   a   NEPAD   initiative,   the   Biosciences   Eastern   and   Central   Africa   (BECA)  (www.biosciencesafrica.org) was established at ILRI. BECA consists of a hub, regional nodes, and  other affiliated laboratories and partner institutes. A state of the art joint Bioinformatics Platform  (www.becabioinfo.org), whose overall goal is to provide a coherent and powerful bioinformatics  infrastructure for use by all scientists in East and central Africa. The Platform goal requires both  physical and intellectual developments that together provide researchers with access to diverse  infrastructure in a wide­area network, thereby addressing four important aspects of bioinformatics: 

1) Science: bioinformatics tools for data integration and visualization, standardization of data  formats and data analysis strategies, and distribution of analysis tasks over local­ and widearea networks are in development; 

2)  Bioinformatics Support Facility: provides assistance and custom programming to projects  and those unable to establish a bioinformatics support function intrinsic to their project due  to shortage of qualified personnel or lack of funding; 

3) Hardware Platform: provide a powerful high performance computing platform capable of  handling the largest analysis needs for projects; 

4) Bioinformatics Training for East and central African scientists: While many Web­based  tools are available to the wet­lab researcher, the Web is not well suited for tasks beyond  single­sequence annotation. Researchers need to become productive in a server­based Unix  environment with its wealth of scripting and automation tools. Even at an entry­level, this  can be an intimidating task if proper guidance is not available.

International Centre of Insect Physiology and Ecology (ICIPE): ICIPE’s research focus is on insect biology, in order to improve the wellbeing of the peoples of the  tropics through insect science. There is a commitment to utilise contemporary science in order to  limit the impact of disease vectors, and agricultural pests. The understanding of the mechanisms  associated with behaviour (e.g. attraction and repellency) is crucial. ICIPE seeks to enhance its  bioinformatics capacity in order to support data from various EST projects designed to gain insights  into the insect ecology and plant pathogen interactions though studies of metabolic pathways  associated with production of all elochemicals. 

Long­term training activities:

Kenyatta University: An introductory course in Bioinformatics is offers to MSc Biotechnology  students. This comprises of 35 hours of lectures and practicals.

University of Nairobi: A centre for Biotechnology and Bioinformatics (CEBIB), which will offer  postgraduate training (diplomas, MSc and PhD) in areas of biotechnology and bioinformatics has  recently been launched. Other universities in Kenya, including Egerton, Maseno and the Jomo Kenyatta University of  Agriculture and Technology offer introductory courses to undergraduates in biomedical sciences. In addition, under the BECA platform MSc and PhD fellowships are being made available for  Bioinformatics students. ILRI is forging links with Universities in South Africa and the United  Kingdom to provide access to courses and training material. 

Research Interest and Activities:

The following are the present areas of research interest: 1. EST clustering 2. Genome sequencing and annotation 3. Functional genomics and proteomics (including key tropical pathogens) 4. Structural bioinformatics 5. Development of Bioinformatics Data Management Systems 6. Gene Mining 7. High Throughput Genotyping 8. Microarray data management and analysis 9. Metagenomics 10. Immunoinformatics 11. Host­pathogen interaction 12. High performance computing and grid development 13. Parasite transfection technologies 14. Cell cycle regulation 15. Population genetics 16. Vector genomics 17. Drug, vaccine and diagnostic target discovery

More at Web site and links:

http://www.ilri.cgiar.org/

http://www.icipe.org/    

http://www.uonbi.ac.ke/cebib

Mulan (http://mulan.dcode.org/), a novel method and a network server for comparing multiple draft and finished-quality sequences to identify functional elements conserved over evolutionary time. Mulan brings together several novel algorithms: the TBA multi-aligner program for rapid identification of local sequence conservation, and the multiTF program for detecting evolutionarily conserved transcription factor binding sites in multiple alignments. In addition, Mulan supports two-way communication with the GALA database; alignments of multiple species dynamically generated in GALA can be viewed in Mulan, and conserved transcription factor binding sites identified with Mulan/multiTF can be integrated and overlaid with extensive genome annotation data using GALA.

Address of the bookmark: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC540288/