RMBlast supports RepeatMasker searches by adding a few necessary features to the stock NCBI blastn program. These include:

• Support for custom matrices ( without KA-Statistics ).
• Support for cross_match-like complexity adjusted scoring. Cross_match is Phil Green's seeded smith-waterman search algorithm.
• Support for cross_match-like masklevel filtering.

https://anaconda.org/bioconda/rmblast

Address of the bookmark: http://www.repeatmasker.org/RMBlast.html

Address of the bookmark: https://kablammo.wasmuthlab.org/

Address of the bookmark: https://www.kegg.jp/blastkoala/

• Store alignments and variant calls for one genome or a million.
• Process genomic data in batch by running principal component analysis or Hardy-Weinberg equilibrium, in minutes or hours, by using parallel computing frameworks like MapReduce.
• Explore data by slicing alignments and variants by genomic range across one or multiple samples -- for your own algorithms or for visualization; or interactively process entire cohorts to find transition/transversion ratios, allelic frequency, genome-wide association and more using BigQuery.
• Share genomic data with your research group, collaborators, the broader community, or the public. You decide.

Google Genomics is implementing the API defined by the Global Alliance for Genomics and Health for visualization, analysis and more. Compliant software can access Google Genomics, local servers, or any other implementation.

Address of the bookmark: https://cloud.google.com/genomics/

As mentioned before, working with BLAST+ in Docker and the cloud has several advantages:

• Docker manages installation and maintenance of the BLAST programs and databases.
• Docker makes it is easier to integrate BLAST with other tools in your pipelines.
• NCBI BLAST databases are pre-loaded now on the both the Google Cloud and Amazon Cloud, providing fast access.

You can also use the BLAST+ Docker image on any Docker-enabled platform, such as another cloud platform or on your local computer.

See the  BLAST+ in the Cloud and  database information documentation to get started.

If you have any questions, please email us at blast-help@ncbi.nlm.nih.gov

Source:Dave Arndt

SLURM is similar in many ways to most other queue systems. You write a batch script then submit it to the queue manager. The queue manager then schedules your job to run on the queue (or partition in SLURM parlance) that you designate. Below we will provide an outline of how to submit jobs to SLURM, how SLURM decides when to schedule your job and how to monitor progress.

SLURM has a number of valuable features compared to other job management systems:

• Kill and Requeue SLURM’s ability to kill and requeue is superior to that of other systems. It waits for jobs to be cleared before scheduling the high priority job. It also does kill and requeue on memory rather than just on core count.
• Memory Memory requests are sacrosanct in SLURM. Thus the amount of memory you request at run time is guaranteed to be there. No one can infringe on that memory space and you cannot exceed the amount of memory that you request.
• Accounting Tools SLURM has a back end database which stores historical information about the cluster. This information can be queried by the users who are curious about how much resources they have used.

Summary of SLURM commands

The table below shows a summary of SLURM commands. These commands are described in more detail below along with links to the SLURM doc site.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Tutorial at http://evomics.org/learning/genomics/satsuma/

Address of the bookmark: http://satsuma.sourceforge.net/