<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43952?</link>
	<atom:link href="https://bioinformaticsonline.com/related/43952?" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/2791/ncbi-psi-blast-tutorial</guid>
	<pubDate>Fri, 23 Aug 2013 02:25:02 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/2791/ncbi-psi-blast-tutorial</link>
	<title><![CDATA[NCBI PSI-BLAST Tutorial]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/T3kHEieyylk" frameborder="0" allowfullscreen></iframe>http:--www.biotechnology.jhu.edu-
Tutorial for PSI-BLAST, an extension of BLAST that uses matrix algebra. BLAST is a cornerstone bioinformatics tool at NCBI. BLAST is the
Basic Local Alignment Search tool and will protein and DNA sequences that
are related to a sequence that the user provides.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37198/understanding-blastn-output-format-6</guid>
	<pubDate>Wed, 27 Jun 2018 18:38:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37198/understanding-blastn-output-format-6</link>
	<title><![CDATA[Understanding BLASTn output format 6 !]]></title>
	<description><![CDATA[<h3 id="sites-page-title-header" style="text-align: left;"><span>BLASTn output format 6</span></h3><div id="sites-canvas-main"><div id="sites-canvas-main-content"><div dir="ltr"><div><div><em>BLASTn</em> maps DNA against DNA, for example gene sequences against a reference genome<br /><br /><code><strong>blastn</strong>  -query <span>genes.ffn</span>  -subject <span>genome.fna</span>  -outfmt <strong>6</strong></code></div><h2>BLASTn tabular output format 6</h2>
<p><strong>Column headers:</strong><br /><code>qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore</code><br /></p>
<table border="1" cellspacing="0">
<tbody>
<tr>
<td> 1.</td>
<td> qseqid</td>
<td> query (e.g., gene) sequence id</td>
</tr>
<tr>
<td> 2.</td>
<td> sseqid</td>
<td> subject (e.g., reference genome) sequence id</td>
</tr>
<tr>
<td> 3.</td>
<td> pident</td>
<td> percentage of identical matches</td>
</tr>
<tr>
<td> 4.</td>
<td> length</td>
<td> alignment length</td>
</tr>
<tr>
<td> 5.</td>
<td> mismatch</td>
<td> number of mismatches</td>
</tr>
<tr>
<td> 6.</td>
<td> gapopen</td>
<td> number of gap openings</td>
</tr>
<tr>
<td> 7.</td>
<td> qstart</td>
<td> start of alignment in query</td>
</tr>
<tr>
<td> 8.</td>
<td> qend</td>
<td> end of alignment in query</td>
</tr>
<tr>
<td> 9.</td>
<td> sstart</td>
<td> start of alignment in subject</td>
</tr>
<tr>
<td> 10.</td>
<td> send</td>
<td> end of alignment in subject</td>
</tr>
<tr>
<td> 11.</td>
<td> evalue</td>
<td> <a href="http://www.metagenomics.wiki/tools/blast/evalue">expect value</a></td>
</tr>
<tr>
<td> 12.</td>
<td> bitscore</td>
<td> <a href="http://www.metagenomics.wiki/tools/blast/evalue"><strong>bit score</strong></a></td>
</tr>
</tbody>
</table>
<p><strong><br /></strong></p>
</div><h2><a name="TOC-Define-your-own-output-format" id="TOC-Define-your-own-output-format"></a>Define your own output format</h2><div><em>by adding the option -outfmt, as for example: </em><strong><br /></strong></div>
<p><code><strong>-outfmt</strong> <strong>"6</strong> <span>qseqid sseqid pident qlen length mismatch gapope evalue bitscore</span><strong>"</strong></code><br /><br /><em><strong>supported format specifiers are:</strong></em><br /><code>qseqid    </code>Query Seq-id<br /><code>qgi       </code>Query GI<br /><code>qacc      </code>Query accesion<br /><code>qaccver   </code>Query accesion.version<br /><code>qlen      </code>Query sequence length<br /><code>sseqid    </code>Subject Seq-id<br /><code>sallseqid </code>All subject Seq-id(s), separated by a ';'<br /><code>sgi       </code>Subject GI<br /><code>sallgi    </code>All subject GIs<br /><code>sacc      </code>Subject accession<br /><code>saccver   </code>Subject accession.version<br /><code>sallacc   </code>All subject accessions<br /><code>slen      </code>Subject sequence length<br /><code>qstart    </code>Start of alignment in query<br /><code>qend      </code>End of alignment in query<br /><code>sstart    </code>Start of alignment in subject<br /><code>send      </code>End of alignment in subject<br /><code>qseq      </code>Aligned part of query sequence<br /><code>sseq      </code>Aligned part of subject sequence<br /><code>evalue    </code>Expect value<br /><code>bitscore  </code>Bit score<br /><code>score     </code>Raw score<br /><code>length    </code>Alignment length<br /><code>pident    </code>Percentage of identical matches<br /><code>nident    </code>Number of identical matches<br /><code>mismatch  </code>Number of mismatches<br /><code>positive  </code>Number of positive-scoring matches<br /><code>gapopen   </code>Number of gap openings<br /><code>gaps      </code>Total number of gaps<br /><code>ppos      </code>Percentage of positive-scoring matches<br /><code>frames    </code>Query and subject frames separated by a '/'<br /><code>qframe    </code>Query frame<br /><code>sframe    </code>Subject frame<br /><code>btop      </code>Blast traceback operations (BTOP)<br /><code>staxids   </code>Subject Taxonomy ID(s), separated by a ';'<br /><code>sscinames </code>Subject Scientific Name(s), separated by a ';'<br /><code>scomnames </code>Subject Common Name(s), separated by a ';'<br /><code>sblastnames </code>Subject Blast Name(s), separated by a ';'   (in alphabetical order)<br /><code>sskingdoms  </code>Subject Super Kingdom(s), separated by a ';'     (in alphabetical order) <br /><code>stitle      </code>Subject Title<br /><code>salltitles  </code>All Subject Title(s), separated by a '&lt;&gt;'<br /><code>sstrand   </code>Subject Strand<br /><code>qcovs     </code>Query Coverage Per Subject<br /><code>qcovhsp   </code>Query Coverage Per HSP<br /><strong><br /><em>default values are:</em></strong><br /><code><code>-outfmt "</code>6 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore"</code></p>
</div></div></div>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44616/basics-of-blast-programs</guid>
	<pubDate>Fri, 26 Jul 2024 06:04:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44616/basics-of-blast-programs</link>
	<title><![CDATA[Basics of BLAST Programs !]]></title>
	<description><![CDATA[<p>The Basic Local Alignment Search Tool (BLAST) is a powerful bioinformatics program used to compare an input sequence (such as DNA, RNA, or protein sequences) against a database of sequences to find regions of similarity. Developed by the National Center for Biotechnology Information (NCBI), BLAST is widely used for identifying species, finding functional and evolutionary relationships between sequences, and predicting the function of novel sequences.</p><p>Key Features of BLAST:<br />1. Sequence Comparison: BLAST searches for local alignments between the query sequence and sequences in a database. It identifies regions of similarity, which can help infer functional and evolutionary relationships.</p><p>2. Speed and Efficiency: BLAST uses heuristic algorithms, making it faster than exhaustive search methods, suitable for large-scale database searches.</p><p>3. Versatility: There are several versions of BLAST for different types of sequence comparisons:<br /> - blastn: Compares a nucleotide query sequence against a nucleotide sequence database.<br /> - blastp: Compares a protein query sequence against a protein sequence database.<br /> - blastx: Compares a nucleotide query sequence translated in all reading frames against a protein sequence database.<br /> - tblastn: Compares a protein query sequence against a nucleotide sequence database translated in all reading frames.<br /> - tblastx: Compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.</p><p>4. Scoring and E-value: BLAST results are scored based on the quality and length of the alignments. The E-value (expect value) indicates the number of alignments one can expect to find by chance, with lower E-values representing more significant matches.</p><p>5. Output Formats: BLAST provides results in various formats, including plain text, HTML, XML, and JSON, making it adaptable for different types of analyses and integrations with other tools.</p><p>Applications of BLAST:<br />- Genomic Research: Identifying genes, understanding genetic diversity, and mapping genome sequences.<br />- Protein Function Prediction: Inferring the function of unknown proteins by comparing them to known protein sequences.<br />- Evolutionary Studies: Exploring evolutionary relationships between organisms by comparing their genetic material.<br />- Medical Research: Identifying pathogens, understanding disease mechanisms, and developing treatments by comparing sequences of interest.</p><p>Overall, BLAST is an essential tool in bioinformatics, offering a reliable and efficient way to analyze and interpret biological sequence data.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40400/blast-2100-released</guid>
	<pubDate>Wed, 18 Dec 2019 20:44:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40400/blast-2100-released</link>
	<title><![CDATA[BLAST+ 2.10.0 released]]></title>
	<description><![CDATA[<p>The BLAST+ 2.10.0 release is now available from at&nbsp;<a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST" target="_blank">FTP site</a>.&nbsp; The new version offers the following improvements:<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></p><ul>
<li>updated composition-based statistics for protein-protein (including translated BLAST) comparisons to provide stable results when you request fewer than the default number of results<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></li>
<li>an experimental Adaptive Composition Based Statistics option that increases the likelihood of finding novel results.&nbsp; To enable this option set the environment variable ADAPTIVE_CBS to 1.&nbsp; We welcome your&nbsp;<a href="mailto:blast-help@ncbi.nlm.nih.gov?subject=BLAST2.10.0%20NCBI%20Insights%20Dec%2017%202019" target="_blank">feedback</a>&nbsp;on this new option.<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></li>
</ul><p>See the&nbsp;<a href="https://www.ncbi.nlm.nih.gov/books/NBK131777/" target="_blank">release notes</a>&nbsp;for details on more&nbsp;&nbsp;improvements and bug fixes with this release.<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></p><p>BLAST+ is also available in docker, please&nbsp;<a href="https://github.com/ncbi/docker/blob/master/blast/README.md" target="_blank">read more</a>&nbsp;for details.<span style="text-decoration: underline;"></span><span style="text-decoration: underline;"></span></p><p>The new version fully supports the version 5 (v5) databases with built in taxonomy and other improvements.&nbsp;For more information on v5 databases (<a href="https://ftp.ncbi.nlm.nih.gov/blast/db/v5/blastdbv5.pdf" target="_blank">download</a>), see the previous&nbsp;<a href="https://ncbiinsights.ncbi.nlm.nih.gov/2019/01/04/blast-2-8-1-with-new-databases-and-better-performance/" target="_blank">NCBI Insights article</a>&nbsp;and the&nbsp;<a href="https://youtu.be/ZZ_K_7-rZj4" target="_blank">recording</a>&nbsp;of our webinar.&nbsp; If you are still using the older version 4 (v4) databases, we recommend you begin using the v5 version as soon as possible.&nbsp; We will discontinue updates to the older v4 databases in early 2020.</p><p>BLAST+ Team</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32376/diamond</guid>
	<pubDate>Thu, 27 Apr 2017 04:21:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32376/diamond</link>
	<title><![CDATA[DIAMOND]]></title>
	<description><![CDATA[<p><span>DIAMOND is a sequence aligner for protein and translated DNA searches and functions as a drop-in replacement for the NCBI BLAST software tools. It is suitable for protein-protein search as well as DNA-protein search on short reads and longer sequences including contigs and assemblies, providing a speedup of BLAST ranging up to x20,000.</span></p>
<p><span>More at&nbsp;file:///home/urbe/Downloads/diamond_manual.pdf</span></p>
<p><span>http://www.nature.com/nmeth/journal/v12/n1/full/nmeth.3176.html</span></p><p>Address of the bookmark: <a href="https://github.com/bbuchfink/diamond" rel="nofollow">https://github.com/bbuchfink/diamond</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/35923/basic-command-line-to-run-blast</guid>
	<pubDate>Wed, 14 Mar 2018 05:10:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/35923/basic-command-line-to-run-blast</link>
	<title><![CDATA[Basic command-line to run BLAST]]></title>
	<description><![CDATA[<p>&nbsp;</p><p>The goal of this tutorial is to run you through a demonstration of the command line, which you may not have seen or used much before.</p><p>All of the commands below can copy/pasted.</p><div id="install-software"><h2>Install software<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#install-software" title="Permalink to this headline"></a></h2><p>Copy and paste the following commands</p><div><div><pre>sudo apt-get update &amp;&amp; sudo apt-get -y install python ncbi-blast+
</pre></div></div><p>This updates the software list and installs the Python programming language and NCBI BLAST+.</p></div><div id="get-data"><h2>Get Data<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#get-data" title="Permalink to this headline"></a></h2><p>Grab some data to play with. Grab some cow and human RefSeq proteins:</p><div><div><pre>wget ftp://ftp.ncbi.nih.gov/refseq/B_taurus/mRNA_Prot/cow.1.protein.faa.gz
wget ftp://ftp.ncbi.nih.gov/refseq/H_sapiens/mRNA_Prot/human.1.protein.faa.gz
</pre></div></div><p>This is only the first part of the human and cow protein files - there are 24 files total for human.</p><p>The database files are both gzipped, so lets unzip them</p><div><div><pre>gunzip *gz
ls
</pre></div></div><p>Take a look at the head of each file:</p><div><div><pre>head cow.1.protein.faa
head human.1.protein.faa
</pre></div></div><p>These are protein sequences in FASTA format. FASTA format is something many of you have probably seen in one form or another &ndash; it&rsquo;s pretty ubiquitous. It&rsquo;s just a text file, containing records; each record starts with a line beginning with a &lsquo;&gt;&rsquo;, and then contains one or more lines of sequence text.</p><p>Note that the files are in fasta format, even though they end if &rdquo;.faa&rdquo; instead of the usual &rdquo;.fasta&rdquo;. This NCBI&rsquo;s way of denoting that this is a fasta file with amino acids instead of nucleotides.</p><p>How many sequences are in each one?</p><div><div><pre>grep -c '^&gt;' cow.1.protein.faa
grep -c '^&gt;' human.1.protein.faa
</pre></div></div><p>This grep command uses the c flag, which reports a count of lines with match to the pattern. In this case, the pattern is a regular expression, meaning match only lines that begin with a &gt;.</p><p>This is a bit too big, lets take a smaller set for practice. Lets take the first two sequences of the cow proteins, which we can see are on the first 6 lines</p><div><div><pre>head -6 cow.1.protein.faa &gt; cow.small.faa
</pre></div></div></div><div id="blast"><h2>BLAST<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#blast" title="Permalink to this headline"></a></h2><p>Now we can blast these two cow sequences against the set of human sequences. First, we need to tell blast about our database. BLAST needs to do some pre-work on the database file prior to searching. This helps to make the software work a lot faster. Because you installed your own version of the sotware, you need to tell the shell where the software is located. Use the full path and the makeblastdb command:</p><div><div><pre>makeblastdb -in human.1.protein.faa -dbtype prot
ls
</pre></div></div><p>Note that this makes a lot of extra files, with the same name as the database plus new extensions (.pin, .psq, etc). To make blast work, these files, called index files, must be in the same directory as the fasta file.</p><p><br /> blastp [-h] [-help] [-import_search_strategy filename]<br /> [-export_search_strategy filename] [-task task_name] [-db database_name]<br /> [-dbsize num_letters] [-gilist filename] [-seqidlist filename]<br /> [-negative_gilist filename] [-negative_seqidlist filename]<br /> [-entrez_query entrez_query] [-db_soft_mask filtering_algorithm]<br /> [-db_hard_mask filtering_algorithm] [-subject subject_input_file]<br /> [-subject_loc range] [-query input_file] [-out output_file]<br /> [-evalue evalue] [-word_size int_value] [-gapopen open_penalty]<br /> [-gapextend extend_penalty] [-qcov_hsp_perc float_value]<br /> [-max_hsps int_value] [-xdrop_ungap float_value] [-xdrop_gap float_value]<br /> [-xdrop_gap_final float_value] [-searchsp int_value]<br /> [-sum_stats bool_value] [-seg SEG_options] [-soft_masking soft_masking]<br /> [-matrix matrix_name] [-threshold float_value] [-culling_limit int_value]<br /> [-best_hit_overhang float_value] [-best_hit_score_edge float_value]<br /> [-window_size int_value] [-lcase_masking] [-query_loc range]<br /> [-parse_deflines] [-outfmt format] [-show_gis]<br /> [-num_descriptions int_value] [-num_alignments int_value]<br /> [-line_length line_length] [-html] [-max_target_seqs num_sequences]<br /> [-num_threads int_value] [-ungapped] [-remote] [-comp_based_stats compo]<br /> [-use_sw_tback] [-version]</p><p>Now we can run the blast job. We will use blastp, which is appropriate for protein to protein comparisons.</p><div><div><pre>blastp -query cow.small.faa -db human.1.protein.faa
</pre></div></div><p>This gives us a lot of information on the terminal screen. But this is difficult to save and use later - Blast also gives the option of saving the text to a file.</p><div><div><pre>    blastp -query cow.small.faa -db human.1.protein.faa -out cow_vs_human_blast_results.txt
ls
</pre></div></div><p>Take a look at the results using less. Note that there can be more than one match between the query and the same subject. These are referred to as high-scoring segment pairs (HSPs).</p><div><div><pre>less cow_vs_human_blast_results.txt
</pre></div></div><p>So how do you know about all the options, such as the flag to create an output file? Lets also take a look at the help pages. Unfortunately there are no man pages (those are usually reserved for shell commands, but some software authors will provide them as well), but there is a text help output</p><div><div><pre>blastp -help
</pre></div></div><p>To scroll through slowly</p><div><div><pre>blastp -help | less
</pre></div></div><p>To quit the less screen, press the q key.</p><p>Parameters of interest include the -evalue (Default is 10?!?) and the -outfmt</p><p>Lets filter for more statistically significant matches with a different output format:</p><div><div><pre>blastp \
-query cow.small.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 7
</pre></div></div><p>I broke the long single command into many lines with by &ldquo;escaping&rdquo; the newline. That forward slash tells the command line &ldquo;Wait, I&rsquo;m not done yet!&rdquo;. So it waits for the next line of the command before executing.</p><p>Check out the results with less.</p><p>Lets try a medium sized data set next</p><div><div><pre>head -199 cow.1.protein.faa &gt; cow.medium.faa
</pre></div></div><p>What size is this db?</p><div><div><pre>grep -c '^&gt;' cow.medium.faa
</pre></div></div><p>Lets run the blast again, but this time lets return only the best hit for each query.</p><div><div><pre>blastp \
-query cow.medium.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 6 \
-max_target_seqs 1
</pre></div></div></div><div id="summary"><h2>Summary<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#summary" title="Permalink to this headline"></a></h2><p>Review:</p><ul>
<li>command line programs such as blast use flags to get information about how and what to do</li>
<li>blast options can be found by typing&nbsp;<cite>blastp -help</cite></li>
<li>break a command up over many lines by using&nbsp;<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#id1">`</a>` to &ldquo;escape&rdquo; the new line</li>
</ul><p>&nbsp;</p><p>Blastn</p><p>blastn [-h] [-help] [-import_search_strategy filename]<br /> [-export_search_strategy filename] [-task task_name] [-db database_name]<br /> [-dbsize num_letters] [-gilist filename] [-seqidlist filename]<br /> [-negative_gilist filename] [-negative_seqidlist filename]<br /> [-entrez_query entrez_query] [-db_soft_mask filtering_algorithm]<br /> [-db_hard_mask filtering_algorithm] [-subject subject_input_file]<br /> [-subject_loc range] [-query input_file] [-out output_file]<br /> [-evalue evalue] [-word_size int_value] [-gapopen open_penalty]<br /> [-gapextend extend_penalty] [-perc_identity float_value]<br /> [-qcov_hsp_perc float_value] [-max_hsps int_value]<br /> [-xdrop_ungap float_value] [-xdrop_gap float_value]<br /> [-xdrop_gap_final float_value] [-searchsp int_value]<br /> [-sum_stats bool_value] [-penalty penalty] [-reward reward] [-no_greedy]<br /> [-min_raw_gapped_score int_value] [-template_type type]<br /> [-template_length int_value] [-dust DUST_options]<br /> [-filtering_db filtering_database]<br /> [-window_masker_taxid window_masker_taxid]<br /> [-window_masker_db window_masker_db] [-soft_masking soft_masking]<br /> [-ungapped] [-culling_limit int_value] [-best_hit_overhang float_value]<br /> [-best_hit_score_edge float_value] [-window_size int_value]<br /> [-off_diagonal_range int_value] [-use_index boolean] [-index_name string]<br /> [-lcase_masking] [-query_loc range] [-strand strand] [-parse_deflines]<br /> [-outfmt format] [-show_gis] [-num_descriptions int_value]<br /> [-num_alignments int_value] [-line_length line_length] [-html]<br /> [-max_target_seqs num_sequences] [-num_threads int_value] [-remote]<br /> [-version]</p><p>DESCRIPTION<br /> Nucleotide-Nucleotide BLAST 2.7.0+</p></div>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/42370/ncbi-blast-have-added-new-columns-to-the-descriptions</guid>
	<pubDate>Tue, 01 Dec 2020 09:56:07 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/42370/ncbi-blast-have-added-new-columns-to-the-descriptions</link>
	<title><![CDATA[NCBI BLAST have added new columns to the Descriptions]]></title>
	<description><![CDATA[<p><span>NCBI BLAST have added new columns to the Descriptions Table for web BLAST output. The new columns are&nbsp; Scientific Name, Common Name, Taxid, and Accession Length. Common Name and Accession Length are now part of the default display. You can click 'Select columns' or 'Manage columns' to add or remove columns from the display Your preferences will be saved for your next visit to BLAST, and when you download your results, whatever columns you have displayed will be saved. See the NCBI Insights post (</span><a href="https://go.usa.gov/x7fPE" target="_blank">https://go.usa.gov/x7fPE</a><span>) for more details.</span></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27216/yass-genomic-similarity-search-tool</guid>
	<pubDate>Mon, 02 May 2016 09:26:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27216/yass-genomic-similarity-search-tool</link>
	<title><![CDATA[YASS :: genomic similarity search tool]]></title>
	<description><![CDATA[<p>YASS is a genomic similarity search tool, for nucleic (DNA/RNA) sequences in fasta or plain text format (<em>it produces local pairwise alignments</em>). Like most of the heuristic pairwise local alignment tools for DNA sequences (FASTA, BLAST, PATTERNHUNTER, BLASTZ/LASTZ, LAST ...), YASS uses <em>seeds</em> to detect potential similarity regions, and then tries to extend them to local alignments. This genomic search tool uses <em>multiple transition constrained spaced seeds</em> that enable to search more fuzzy repeats, as non-coding DNA/RNA. Another simple, but interesting feature is that you can specify the seed pattern used in the search step (as provided for example by <a href="http://bioinfo.lifl.fr/yass/iedera.php">iedera</a>).</p>
<p>Main features of YASS are:</p>
<ul>
<li>multiple, possibly overlapping seeds and a new hit criterion to ensure a good sensitivity/selectivity trade-off</li>
<li>transition-constrained spaced seeds to improve sensitivity (transition mutations are purine to purine [<code>A&lt;-&gt;G</code>] or pyrimidine to pyrimidine [<code>C&lt;-&gt;T</code>])</li>
<li>using different scoring schemes with bit-score and E-value evaluated according to the sequence background frequencies</li>
<li>parameterizable <em>output</em> filter for low complexity repeats</li>
<li>reporting of various alignment statistical parameters (mutation bias along triplets, transition/transversion)</li>
<li>post-processing step to group gapped alignments</li>
</ul><p>Address of the bookmark: <a href="http://bioinfo.lifl.fr/yass/" rel="nofollow">http://bioinfo.lifl.fr/yass/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30375/mauve-a-system-for-constructing-multiple-genome-alignments-in-the-presence-of-large-scale-evolutionary-events-such-as-rearrangement-and-inversion</guid>
	<pubDate>Sat, 24 Dec 2016 09:20:53 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30375/mauve-a-system-for-constructing-multiple-genome-alignments-in-the-presence-of-large-scale-evolutionary-events-such-as-rearrangement-and-inversion</link>
	<title><![CDATA[Mauve: a system for constructing multiple genome alignments in the presence of large-scale evolutionary events such as rearrangement and inversion]]></title>
	<description><![CDATA[<p>Mauve is a system for constructing multiple genome alignments in the presence of large-scale evolutionary events such as rearrangement and inversion. Multiple genome alignments provide a basis for research into comparative genomics and the study of genome-wide evolutionary dynamics.</p>
<p>Mauve has been developed with the idea that a multiple genome aligner should require only modest computational resources. It employs algorithmic techniques that scale well in the lengths of sequences being aligned. For example, a pair of&nbsp;<em>Y. pestis</em>&nbsp;genomes can be aligned in under a minute, while a group of 9 divergent Enterobacterial genomes can be aligned in a few hours. However, the current algorithm&rsquo;s compute time (progressiveMauve) scales cubically in the number of genomes to align, making it unsuitable for datasets containing more than 50-100 bacterial genomes.</p><p>Address of the bookmark: <a href="http://darlinglab.org/mauve/mauve.html" rel="nofollow">http://darlinglab.org/mauve/mauve.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>