mod_rewrite provides a flexible and powerful way to manipulate URLs using an unlimited number of rules. Each rule can have an unlimited number of attached rule conditions, to allow you to rewrite URL based on server variables, environment variables, HTTP headers, or time stamps.

mod_rewrite operates on the full URL path, including the path-info section. A rewrite rule can be invoked in httpd.conf or in .htaccess. The path generated by a rewrite rule can include a query string, or can lead to internal sub-processing, external request redirection, or internal proxy throughput.

Further details, discussion, and examples, are provided in the detailed mod_rewrite documentation.

• sudo a2enmod rewrite

• sudo systemctl restart apache2

• sudo nano /etc/apache2/sites-available/000-default.conf

Write this

<VirtualHost *:80>
    <Directory /var/www/html>
        Options Indexes FollowSymLinks MultiViews
        AllowOverride All
        Require all granted
    </Directory>

    . . .
</VirtualHost>

Address of the bookmark: https://www.digitalocean.com/community/tutorials/how-to-rewrite-urls-with-mod_rewrite-for-apache-on-ubuntu-18-04

In this tutorial, we will show you how to install and configure Elgg social networking platform on Ubuntu 20.04.

Prerequisites

• A fresh Ubuntu 20.04 VPS on the Atlantic.net Cloud Platform
• A valid domain name pointed to your server IP
• A root password configured on your server

Step 1 – Create Atlantic.Net Cloud Server

First, log in to your Atlantic.Net Cloud Server. Create a new server, choosing Ubuntu 20.04 as the operating system with at least 2GB RAM. Connect to your Cloud Server via SSH and log in using the credentials highlighted at the top of the page.

Once you are logged in to your Ubuntu 20.04 server, run the following command to update your base system with the latest available packages.

apt-get update -y

Step 2 – Install Apache, MariaDB and PHP

Elgg runs on Apache web server, is written in PHP, and uses MySQL/MariaDB as a database backend, so you will need to install the Apache, MariaDB, PHP and other required PHP extensions to your server. You can install all of them with the following command:

apt-get install apache2 mariadb-server php libapache2-mod-php php-common php-sqlite3 php-curl 
php-intl php-mbstring php-xmlrpc php-mysql php-gd php-xml php-cli php-zip unzip wget -y

After installing all the packages, edit the php.ini file and change some recommended settings.

nano /etc/php/7.4/apache2/php.ini

Change the following values:

max_execution_time = 300
memory_limit = 512M
upload_max_filesize = 100M
date.timezone = Asia/Kolkata

Save and close the file, then restart the Apache service to apply the configuration changes.

systemctl restart apache2

Step 3 – Create a Database for Elgg

Next, you will need to create a database and user for Elgg. First, log in to MySQL shell with the following command:

mysql

Once logged in, create a database and user with the following command:

CREATE DATABASE elgg;
CREATE USER 'elgg'@'localhost' IDENTIFIED BY 'secure-password';

Next, grant all the privileges to the elgg database with the following command:

GRANT ALL ON elgg.* TO 'elgg'@'localhost' IDENTIFIED BY 'secure-password' WITH GRANT 
OPTION;

Next, flush the privileges and exit from the MariaDB shell with the following command:

FLUSH PRIVILEGES;
EXIT;

At this point, the MariaDB database is created for Elgg.

Step 4 – Install Elgg

First, download the latest version of Elgg from its official website using the following command:

wget https://elgg.org/download/elgg-3.3.13.zip

Once the download is completed, unzip the downloaded file with the following command:

unzip elgg-3.3.13.zip

Next, move the extracted directory to the Apache root directory:

mv elgg-3.3.13 /var/www/html/elgg

Next, create a data directory and set proper ownership and permissions to the Elgg directory:

mkdir /var/www/html/data
chown -R www-data:www-data /var/www/html/elgg
chown -R www-data:www-data /var/www/html/data
chmod -R 755 /var/www/html/elgg

Once you are finished, you can proceed to the next step.

Step 5 – Configure Apache for Elgg

Next, you will need to configure Apache to serve Elgg. You can configure it by creating a new Apache virtual host configuration file:

nano /etc/apache2/sites-available/elgg.conf

Add the following lines:

<VirtualHost *:80>
ServerAdmin admin@example.com
DocumentRoot /var/www/html/elgg/
ServerName elgg.example.com
Options FollowSymLinks
AllowOverride All
ErrorLog /var/log/apache2/elgg-error_log
CustomLog /var/log/apache2/elgg-access_log common
</VirtualHost>

Save and close the file, then enable the virtual host and Apache rewrite module with the following command:

a2ensite elgg.conf
a2enmod rewrite

Finally, restart the Apache service to apply the changes:

systemctl restart apache2

Step 6 – Access Elgg Web Interface

Now, open your web browser and access the Elgg web interface using the URL http://elgg.example.com. You should see the Elgg welcome screen:

• Bioconductor – A plethora of tools for analysis and comprehension of high-throughput genomic data, including 1500+ software packages. [ paper-2004 | web ]
• Biopython – Freely available tools for biological computing in Python, with included cookbook, packaging and thorough documentation. Part of the Open Bioinformatics Foundation. Contains the very useful Entrez package for API access to the NCBI databases. [ paper-2009 | web ]
• Bioconda – A channel for the conda package manager specializing in bioinformatics software. Includes a repository with 3000+ ready-to-install (with conda install) bioinformatics packages. [ paper-2018 | web ]
• BioJulia – Bioinformatics and computational biology infastructure for the Julia programming language. [ web ]
• Rust-Bio – Rust implementations of algorithms and data structures useful for bioinformatics. [ paper-2016 ]
• SeqAn – The modern C++ library for sequence analysis.

Address of the bookmark: https://github.com/broadinstitute/VariantBam

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Then I thaught it migh be a problem of graphical display and I opened the terminal out of curiosity, and I found out that there is no ~/Desktop folder at all. What happened? What do I need to do?

Then I google the problem and found this is a very common problem after updates. To fix this problem, follow these steps:

You need to edit the ~/.config/user-dirs.dirs file, and make sure the contents of the file are like the following:

XDG_DESKTOP_DIR="$HOME/Desktop"
XDG_DOWNLOAD_DIR="$HOME/Downloads"
XDG_TEMPLATES_DIR="$HOME/"
XDG_PUBLICSHARE_DIR="$HOME/Share"
XDG_DOCUMENTS_DIR="$HOME/Documents"
XDG_MUSIC_DIR="$HOME/Music"
XDG_PICTURES_DIR="$HOME/Pictures"
XDG_VIDEOS_DIR="$HOME/Videos"

Then restart nautilus:

killall nautilus

or

nautilus -q

Then, open nautilus via Unity menu (press the Super key) or using the run command (Alt+F2)

Settings file

• Error

  Your web server does not have permission to create the settings.php file in your installation directory. You have two choices:

  1. Change the permissions on the elgg-config directory of your Elgg installation

  2. Copy the file elgg-config/settings.example.php to elgg-config/settings.php and follow the instructions in it for setting your database parameters.

To resolve this -- 

Change the permision 

chmod 777 elgg-config

Web server

• Warning

  Your server does not support automatic testing of the rewrite rules and your browser does not support checking via JavaScript. You can continue the installation, but you may experience problems with your site. You can manually test the rewrite rules by clicking this link: test. You will see the word success if the rules are working.

create a .httaccess

and provide detail in it

Installation of Elgg

(Note: Elgg requires installing an instance of MySQL.)

Steps to make adjustment and disposal of trial installations easier.

MySQL

At this point, we assume you've set up your MySQL database

Elgg

Copy & Paste this line into your terminal:

\curl -L https://install.perlbrew.pl | bash

Or, if your system does not have curl but something else:

# Linux
\wget -O - https://install.perlbrew.pl | bash

# FreeBSD
\fetch -o- https://install.perlbrew.pl | sh

If you prefer to install with cpan, there are two steps:

sudo cpan App::perlbrew
perlbrew init

If it is installed with cpan, the perlbrew executable should be installed as /usr/bin/perlbrew or /usr/local/bin/perlbrew. For all users who want to use perlbrew, a prior perlbrew init needs to be executed.

The default perlbrew root directory is ~/perl5/perlbrew, which can be changed by setting PERLBREW_ROOTenvironment variable before the installation and initialization. For more advanced installation process, please read the perlbrew document.

Address of the bookmark: https://perlbrew.pl/