<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/43954?</link>
	<atom:link href="https://bioinformaticsonline.com/related/43954?" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43587/fix-rewritable-error-of-elgg</guid>
	<pubDate>Mon, 15 Nov 2021 06:23:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43587/fix-rewritable-error-of-elgg</link>
	<title><![CDATA[Fix rewritable error of ELGG !]]></title>
	<description><![CDATA[<p>The&nbsp;<code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;module uses a rule-based rewriting engine, based on a PCRE regular-expression parser, to rewrite requested URLs on the fly. By default,&nbsp;<code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;maps a URL to a filesystem path. However, it can also be used to redirect one URL to another URL, or to invoke an internal proxy fetch.</p>
<p><code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;provides a flexible and powerful way to manipulate URLs using an unlimited number of rules. Each rule can have an unlimited number of attached rule conditions, to allow you to rewrite URL based on server variables, environment variables, HTTP headers, or time stamps.</p>
<p><code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;operates on the full URL path, including the path-info section. A rewrite rule can be invoked in&nbsp;<code>httpd.conf</code>&nbsp;or in&nbsp;<code>.htaccess</code>. The path generated by a rewrite rule can include a query string, or can lead to internal sub-processing, external request redirection, or internal proxy throughput.</p>
<p>Further details, discussion, and examples, are provided in the&nbsp;<a href="https://httpd.apache.org/docs/2.4/rewrite/">detailed mod_rewrite documentation</a>.</p>
<p>&nbsp;</p>
<ul>
<li>sudo a2enmod rewrite</li>
</ul>
<ul>
<li>sudo systemctl restart apache2</li>
</ul>
<ul>
<li>sudo nano /etc/apache2/sites-available/000-default.conf</li>
</ul>
<p>Write this</p>
<div title="/etc/apache2/sites-available/000-default.conf">/etc/apache2/sites-available/000-default.conf</div>
<div>
<div>
<pre><code><span>&lt;</span>VirtualHost *:8<span><span>0</span>&gt;</span>
    <span></span><span><span>&lt;</span>Directory /var/www/html<span>&gt;</span></span><span></span>
        <span>Options Indexes FollowSymLinks MultiViews</span>
        <span>AllowOverride All</span>
        <span>Require all granted</span>
    <span></span><span><span>&lt;</span>/Directory<span>&gt;</span></span><span></span>

    <span>.</span> <span>.</span> <span>.</span>
<span>&lt;</span>/VirtualHost<span>&gt;</span></code></pre>
</div>
</div><p>Address of the bookmark: <a href="https://www.digitalocean.com/community/tutorials/how-to-rewrite-urls-with-mod_rewrite-for-apache-on-ubuntu-18-04" rel="nofollow">https://www.digitalocean.com/community/tutorials/how-to-rewrite-urls-with-mod_rewrite-for-apache-on-ubuntu-18-04</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/43872/installing-elgg-on-ubuntu</guid>
	<pubDate>Wed, 25 May 2022 02:26:05 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/43872/installing-elgg-on-ubuntu</link>
	<title><![CDATA[Installing ELGG on Ubuntu !]]></title>
	<description><![CDATA[<p>Elgg is an open-source and highly customizable framework used for building an online social environment. It provides a simple and powerful user interface that helps to manage and build your content through a web browser. Elgg offers a rich set of features including messaging, microblogging, file-sharing, RSS support, access control, groups, and many more.</p><p>&nbsp;</p><p>In this tutorial, we will show you how to install and configure Elgg social networking platform on Ubuntu 20.04.</p><h2>Prerequisites</h2><p>&bull; A fresh Ubuntu 20.04&nbsp;<a href="https://www.atlantic.net/vps-hosting/">VPS</a>&nbsp;on the Atlantic.net Cloud Platform<br />&bull; A valid domain name pointed to your server IP<br />&bull; A root password configured on your server</p><h2>Step 1 &ndash; Create Atlantic.Net Cloud Server</h2><p>First, log in to your&nbsp;<a href="https://cloud.atlantic.net/?page=userlogin" target="_blank">Atlantic.Net Cloud Server</a>. Create a new&nbsp;<a href="https://www.atlantic.net/vps-hosting/how-to-create-new-atlantic-net-cloud-server/">server</a>, choosing Ubuntu 20.04 as the operating system with at least 2GB RAM. Connect to your Cloud Server via SSH and log in using the credentials highlighted at the top of the page.</p><p>Once you are logged in to your Ubuntu 20.04 server, run the following command to update your base system with the latest available packages.</p><pre>apt-get update -y</pre><h2>Step 2 &ndash; Install Apache, MariaDB and PHP</h2><p>Elgg runs on Apache web server, is written in PHP, and uses MySQL/MariaDB as a database backend, so you will need to install the Apache, MariaDB, PHP and other required PHP extensions to your server. You can install all of them with the following command:</p><pre>apt-get install apache2 mariadb-server php libapache2-mod-php php-common php-sqlite3 php-curl 
php-intl php-mbstring php-xmlrpc php-mysql php-gd php-xml php-cli php-zip unzip wget -y</pre><p>After installing all the packages, edit the php.ini file and change some recommended settings.</p><pre>nano /etc/php/7.4/apache2/php.ini</pre><p>Change the following values:</p><pre>max_execution_time = 300
memory_limit = 512M
upload_max_filesize = 100M
date.timezone = Asia/Kolkata</pre><p>Save and close the file, then restart the Apache service to apply the configuration changes.</p><pre>systemctl restart apache2</pre><h2>Step 3 &ndash; Create a Database for Elgg</h2><p>Next, you will need to create a database and user for Elgg. First, log in to MySQL shell with the following command:</p><pre>mysql</pre><p>Once logged in, create a database and user with the following command:</p><pre>CREATE DATABASE elgg;
CREATE USER 'elgg'@'localhost' IDENTIFIED BY 'secure-password';</pre><p>Next, grant all the privileges to the elgg database with the following command:</p><pre>GRANT ALL ON elgg.* TO 'elgg'@'localhost' IDENTIFIED BY 'secure-password' WITH GRANT 
OPTION;</pre><p>Next, flush the privileges and exit from the MariaDB shell with the following command:</p><pre>FLUSH PRIVILEGES;
EXIT;</pre><p>At this point, the MariaDB database is created for Elgg.</p><h2>Step 4 &ndash; Install Elgg</h2><p>First, download the latest version of Elgg from its official website using the following command:</p><pre>wget https://elgg.org/download/elgg-3.3.13.zip</pre><p>Once the download is completed, unzip the downloaded file with the following command:</p><pre>unzip elgg-3.3.13.zip</pre><p>Next, move the extracted directory to the Apache root directory:</p><pre>mv elgg-3.3.13 /var/www/html/elgg</pre><p>Next, create a data directory and set proper ownership and permissions to the Elgg directory:</p><pre>mkdir /var/www/html/data
chown -R www-data:www-data /var/www/html/elgg
chown -R www-data:www-data /var/www/html/data
chmod -R 755 /var/www/html/elgg</pre><p>Once you are finished, you can proceed to the next step.</p><h2>Step 5 &ndash; Configure Apache for Elgg</h2><p>Next, you will need to configure Apache to serve Elgg. You can configure it by creating a new Apache virtual host configuration file:</p><pre>nano /etc/apache2/sites-available/elgg.conf</pre><p>Add the following lines:</p><pre>&lt;VirtualHost *:80&gt;
ServerAdmin admin@example.com
DocumentRoot /var/www/html/elgg/
ServerName elgg.example.com
Options FollowSymLinks
AllowOverride All
ErrorLog /var/log/apache2/elgg-error_log
CustomLog /var/log/apache2/elgg-access_log common
&lt;/VirtualHost&gt;</pre><p>Save and close the file, then enable the virtual host and Apache rewrite module with the following command:</p><pre>a2ensite elgg.conf
a2enmod rewrite</pre><p>Finally, restart the Apache service to apply the changes:</p><pre>systemctl restart apache2</pre><h2>Step 6 &ndash; Access Elgg Web Interface</h2><p>Now, open your web browser and access the Elgg web interface using the URL http://elgg.example.com. You should see the Elgg welcome screen:</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42974/list-of-bioinformatics-packages-for-ngs-analysis</guid>
	<pubDate>Sat, 20 Mar 2021 00:28:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42974/list-of-bioinformatics-packages-for-ngs-analysis</link>
	<title><![CDATA[List of bioinformatics packages for NGS analysis !]]></title>
	<description><![CDATA[<p>Package suites gather software packages and installation tools for specific languages or platforms. We have some for bioinformatics software.</p><ul>
<li><a href="https://github.com/Bioconductor">Bioconductor</a>&nbsp;&ndash; A plethora of tools for analysis and comprehension of high-throughput genomic data, including 1500+ software packages. [&nbsp;<a href="https://link.springer.com/article/10.1186/gb-2004-5-10-r80">paper-2004</a>&nbsp;|&nbsp;<a href="https://www.bioconductor.org/">web</a>&nbsp;]</li>
<li><a href="https://github.com/biopython/biopython">Biopython</a>&nbsp;&ndash; Freely available tools for biological computing in Python, with included cookbook, packaging and thorough documentation. Part of the&nbsp;<a href="http://open-bio.org/">Open Bioinformatics Foundation</a>. Contains the very useful&nbsp;<a href="https://biopython.org/DIST/docs/api/Bio.Entrez-module.html">Entrez</a>&nbsp;package for API access to the NCBI databases. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/19304878">paper-2009</a>&nbsp;|&nbsp;<a href="https://biopython.org/">web</a>&nbsp;]</li>
<li><a href="https://github.com/bioconda">Bioconda</a>&nbsp;&ndash; A channel for the&nbsp;<a href="http://conda.pydata.org/docs/intro.html">conda package manager</a>&nbsp;specializing in bioinformatics software. Includes a repository with 3000+ ready-to-install (with&nbsp;<code>conda install</code>) bioinformatics packages. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/29967506">paper-2018</a>&nbsp;|&nbsp;<a href="https://bioconda.github.io/">web</a>&nbsp;]</li>
<li><a href="https://github.com/BioJulia">BioJulia</a>&nbsp;&ndash; Bioinformatics and computational biology infastructure for the Julia programming language. [&nbsp;<a href="https://biojulia.net/">web</a>&nbsp;]</li>
<li><a href="https://github.com/rust-bio/rust-bio">Rust-Bio</a>&nbsp;&ndash; Rust implementations of algorithms and data structures useful for bioinformatics. [&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/early/2015/10/06/bioinformatics.btv573.short?rss=1">paper-2016</a>&nbsp;]</li>
<li><a href="https://github.com/seqan/seqan3">SeqAn</a>&nbsp;&ndash; The modern C++ library for sequence analysis.</li>
</ul>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37835/variantbam-filtering-and-profiling-of-next-generational-sequencing-data-using-region-specific-rules</guid>
	<pubDate>Thu, 04 Oct 2018 16:30:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37835/variantbam-filtering-and-profiling-of-next-generational-sequencing-data-using-region-specific-rules</link>
	<title><![CDATA[VariantBam: Filtering and profiling of next-generational sequencing data using region-specific rules]]></title>
	<description><![CDATA[<p>VariantBam is a tool to extract/count specific sets of sequencing reads from next-generational sequencing files. To save money, disk space and I/O, one may not want to store an entire BAM on disk. In many cases, it would be more efficient to store only those read-pairs or reads who intersect some region around the variant locations. Alternatively, if your scientific question is focused on only one aspect of the data (e.g. breakpoints), many reads can be removed without losing the information relevant to the problem.</p>
<h5>&nbsp;</h5><p>Address of the bookmark: <a href="https://github.com/broadinstitute/VariantBam" rel="nofollow">https://github.com/broadinstitute/VariantBam</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/26395/biolinux-ubuntu-desktop-folder-and-files-disappeared</guid>
	<pubDate>Tue, 16 Feb 2016 08:40:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/26395/biolinux-ubuntu-desktop-folder-and-files-disappeared</link>
	<title><![CDATA[BioLinux Ubuntu Desktop folder and files disappeared !!]]></title>
	<description><![CDATA[<p>Restarted my BioLinux ubuntu computer after an update, and when I logged back in, I noticed that all of my files went missing. Instead of Desktop folder, icons of all of my home folder are showed on desktop.</p><p>Then I thaught it migh be a problem of graphical display and I opened the terminal out of curiosity, and I found out that there is no ~/Desktop folder at all. What happened? What do I need to do?</p><p>Then I google the problem and found this is a very common problem after updates. To fix this problem, follow these steps:</p><p>You need to edit the ~/.config/user-dirs.dirs file, and make sure the contents of the file are like the following:<br /><br />XDG_DESKTOP_DIR="$HOME/Desktop"<br />XDG_DOWNLOAD_DIR="$HOME/Downloads"<br />XDG_TEMPLATES_DIR="$HOME/"<br />XDG_PUBLICSHARE_DIR="$HOME/Share"<br />XDG_DOCUMENTS_DIR="$HOME/Documents"<br />XDG_MUSIC_DIR="$HOME/Music"<br />XDG_PICTURES_DIR="$HOME/Pictures"<br />XDG_VIDEOS_DIR="$HOME/Videos"<br /><br />Then restart nautilus:<br /><br />killall nautilus<br /><br />or<br /><br />nautilus -q<br /><br />Then, open nautilus via Unity menu (press the Super key) or using the run command (Alt+F2)</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/43605/installing-elgg-on-ubuntu</guid>
	<pubDate>Thu, 25 Nov 2021 01:45:59 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/43605/installing-elgg-on-ubuntu</link>
	<title><![CDATA[Installing ELGG on Ubuntu !]]></title>
	<description><![CDATA[<p>Follow this:</p><h3>Settings file</h3><ul>
<li>
<div>
<div>
<div>Error</div>
<div>
<p>Your web server does not have permission to create the settings.php file in your installation directory. You have two choices:</p>
<p>1. Change the permissions on the elgg-config directory of your Elgg installation</p>
<p>2. Copy the file elgg-config/settings.example.php to elgg-config/settings.php and follow the instructions in it for setting your database parameters.</p>
</div>
</div>
</div>
</li>
</ul><p>&nbsp;</p><p>To resolve this --&nbsp;</p><p>Change the permision&nbsp;</p><p>chmod 777 elgg-config</p><h3>Web server</h3><ul>
<li>
<div>
<div>
<div>Warning</div>
<div>
<p>Your server does not support automatic testing of the rewrite rules and your browser does not support checking via JavaScript. You can continue the installation, but you may experience problems with your site. You can manually test the rewrite rules by clicking this link:&nbsp;test. You will see the word success if the rules are working.</p>
</div>
</div>
</div>
</li>
</ul><p>create a .httaccess</p><p>and provide detail in it</p><p><span style="text-decoration: underline;">Installation of Elgg</span><span></span></p><p>&nbsp;</p><p>(Note: Elgg requires&nbsp;<a href="http://www.cs.oswego.edu/~odendahl/misc/howto/mysql/">installing an instance of MySQL</a>.)</p><p>&nbsp;</p><p><span style="text-decoration: underline;">Steps to make adjustment and disposal of trial installations easier</span>.</p><p>&nbsp;</p><p><span style="text-decoration: underline;">MySQL</span></p><p>At this point, we assume you've set up your&nbsp;<tt>MySQL</tt>&nbsp;database</p><div><ol>
<li>Start your&nbsp;<tt>mysqld</tt>&nbsp;server daemon.<br />(For the sake of this example, we'll assume we're running on port 9999; you shouldn't actually use this port because only one daemon can run on any port number.)</li>
<li>Login to the server as&nbsp;<tt>root</tt>&nbsp;user, using the&nbsp;<tt>mysql</tt>&nbsp;client.</li>
<li>Create a database to store Elgg's tables. We'll call the database&nbsp;<tt>elggalpha</tt>.<br /><tt>mysql&gt; create database elggalpha;</tt></li>
<li>Grant access to a user &mdash; for this example we'll call him/her&nbsp;<tt>elggalphauser</tt>.
<pre>mysql&gt; grant all privileges on elggalpha.* to 'elggalphauser'@'moxie'
    -&gt; identified by 'secretpassword';
</pre>
</li>
</ol></div><p>&nbsp;</p><p><span style="text-decoration: underline;">Elgg</span></p><p>&nbsp;</p><div><ol>
<li>Type&nbsp;<tt>umask 022</tt></li>
<li>Change into your&nbsp;<tt>public_html</tt>&nbsp;directory (<em>aka</em>&nbsp;folder).<br /><tt>cd public_html</tt></li>
<li>make a directory called&nbsp;<tt>elgg</tt><br /><tt>mkdir elgg</tt></li>
<li>Change into the&nbsp;<tt>elgg</tt>&nbsp;subdirectory of&nbsp;<tt>public_html</tt>.<br /><tt>cd elgg</tt></li>
<li>download elgg into this directory</li>
<li>you'll end up with a file named<br /><tt>/home/<em>your-user-id</em>/public_html/elgg/elgg-X.X.X.X.zip</tt><br />(It's not literally&nbsp;<tt>X.X.X.X</tt>, it might be&nbsp;<tt>elgg-1.8.0.1.zip</tt>, for example.)</li>
<li>unzip elgg<br /><tt>unzip -q elgg-1.8.0.1.zip</tt></li>
<li>you'll end up with a directory (folder) named<br /><tt>/home/<em>your-user-id</em>/public_html/elgg/elgg-X.X.X.X</tt></li>
<li>make a symbolic link (<em>aka</em>&nbsp;shortcut) to this<br /><tt>ln -s elgg-X.X.X.X alpha</tt><br />(For example,&nbsp;<tt>ln -s elgg-1.8.0.1 alpha</tt>)</li>
<li>Give user&nbsp;<tt>nobody</tt>&nbsp;access to this directory<br /><tt>/usr/misc/bin/acl.sh -r -u nobody elgg-1.8.0.1</tt></li>
<li>create a data directory for&nbsp;<tt>elgg</tt>&nbsp;(get into your home directory first):
<pre>cd
mkdir -p elgg/alpha/data
chmod -R 755 elgg/alpha/data
</pre>
</li>
<li>Change into the&nbsp;<tt>elgg/alpha</tt>&nbsp;directory.<br /><tt>cd elgg/alpha</tt></li>
<li>Give user&nbsp;<tt>nobody</tt>&nbsp;access to this subdirectory&nbsp;<tt>data</tt><br /><tt>/usr/misc/bin/acl.sh -u nobody data</tt></li>
<li>In your browser, navigate to your elgg installation<br /><tt>http://moxie.cs.oswego.edu/~<em>your-user-id</em>/elgg/alpha/</tt><br />You'll have a screen which includes this message:
<pre>Welcome

Installing Elgg has 6 simple steps and reading this welcome is the first one!

If you haven't already, read through the installation instructions included with Elgg (or click the instructions link at the bottom of the page).

If you are ready to proceed, click the Next button.
</pre>
</li>
<li>Follow configuration process:
<ul>
<li>The first screen probably will contain a success message in green and a failure message in pink:
<pre><span>Requirements check</span>

Your server failed the requirements check. After you have fixed the below issues, refresh this
page. Check the troubleshooting links at the bottom of this page if you need further assistance.
<span>PHP</span></pre>
<div>Your server's PHP satisfies all of Elgg's requirements.</div>
<pre>
<span>Web server</span></pre>
<div>We think your server is running the Apache web server. The rewrite test failed and the most likely cause is that AllowOverride is not set to All for Elgg's directory. This prevents Apache from processing the .htaccess file which contains the rewrite rules. A less likely cause is Apache is configured with an alias for your Elgg directory and you need to set the RewriteBase in your .htaccess. There are further instructions in the .htaccess file in your Elgg directory.</div>
<pre>
<span>Database</span></pre>
<div>The database requirements are checked when Elgg loads its database.</div>
</li>
<li>To correct this, replace the&nbsp;<tt>.htaccess</tt>&nbsp;file that Elgg created with one that you can edit:
<pre>cp -ip .htaccess temp-htaccess
rm .htaccess
mv temp-htaccess .htaccess
</pre>
</li>
<li>Edit the&nbsp;<tt>.htaccess</tt>&nbsp;file: Go to approximately line 101 (where it says&nbsp;<tt>#RewriteBase /</tt>) and add the line:<br /><tt>RewriteBase /~<em>your-user-id</em>/elgg/alpha/</tt></li>
<li>Be sure to save the edited file.
<p>&nbsp;</p>
<p>&nbsp;</p>
</li>
<li>Click the&nbsp;<span>Refresh</span>&nbsp;button.
<p>&nbsp;</p>
<p>&nbsp;</p>
</li>
<li>If this hasn't fixed things, seek professional help.
<p>&nbsp;</p>
<p>&nbsp;</p>
</li>
<li>Click the&nbsp;<span>Next</span>&nbsp;button.
<p>&nbsp;</p>
<p>&nbsp;</p>
</li>
<li>Fill in the parameters appropriate to your MySQL installation.
<pre><span>Database installation</span>

If you haven't already created a database for Elgg, do that now. Then fill in the values below to
initialize the Elgg database.

<span>Database Username</span></pre>
<div>elggalphauser</div>
<pre>User that has full priviledges to the MySQL database that you created for Elgg

<span>Database Password</span></pre>
<div>secretpassword</div>
<pre>Password for the above database user account

<span>Database Name</span></pre>
<div>elggalpha</div>
<pre>Name of the Elgg database

<span>Database Host</span></pre><sup>&Dagger;</sup>
<div>moxie:9999</div>
<pre>Hostname of the MySQL server (usually localhost)
<strong>&Dagger;You might need to use <tt>127.0.0.1:9999</tt> for the host
    if you haven't set up MySQL as we've done.</strong>



<span>Database Table Prefix</span></pre>
<div>elgg_</div>
<pre>The prefix given to all of Elgg's tables (usually elgg_)
</pre>
<div><span>Next</span></div>
<p>&nbsp;</p>
<p>&nbsp;</p>
</li>
<li>Continue filling in forms as requested.
<pre>Configure site</pre>
<div>Database has been installed.</div>
<pre>
We need some information about the site as we configure Elgg. If you haven't created a data directory for Elgg, you need to do so now.

<span>Site Name</span></pre>
<div>My Elgg Site version Alpha</div>
<pre>The name of your new Elgg site

<span>Site Email Address</span></pre>
<div><em>your-user-id</em>@oswego.edu</div>
<pre>Email address used by Elgg for communication with users

<span>Site URL</span></pre>
<div>http://moxie.cs.oswego.edu/~<em>your-user-id</em>/elgg/alpha/</div>
<pre>The address of the site (Elgg usually guesses this correctly)

<span>Elgg Install Directory</span></pre>
<div>/home/<em>your-user-id</em>/public_html/elgg/elgg.1.8.0.1/</div>
<pre>The directory where you put the Elgg code (Elgg usually guesses this correctly)

<span>Data Directory</span></pre>
<div>/home/<em>your-user-id</em>/elgg/alpha/data</div>
<pre>The directory that you created for Elgg to save files (the permissions on this directory are checked
when you click Next)

<span>Default Site Access</span></pre>
<div>Public</div>
<pre>The default access level for new user created content
</pre>
</li>
<li>
<pre><span>Create admin account</span></pre>
<div>Site settings have been saved.</div>
<pre>
It is now time to create an administrator's account.

<span>Display Name</span></pre>
<div>&nbsp;</div>
<pre>The name that is displayed on the site for this account

<span>Email Address</span></pre>
<div>&nbsp;</div>
<pre>
<span>Username</span></pre>
<div>&nbsp;</div>
<pre>Account username used for logging in

<span>Password</span></pre>
<div>&nbsp;</div>
<pre>Account password must be at least 6 characters long

<span>Password Again</span></pre>
<div>&nbsp;</div>
<pre>Retype password to confirm</pre>
</li>
</ul>
</li>
</ol></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33866/perlbrew-admin-free-perl-installation-management-tool</guid>
	<pubDate>Wed, 12 Jul 2017 03:53:08 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33866/perlbrew-admin-free-perl-installation-management-tool</link>
	<title><![CDATA[Perlbrew: admin-free perl installation management tool.]]></title>
	<description><![CDATA[<p>perlbrew is an admin-free perl installation management tool. The latest version is 0.79, read the release note:&nbsp;<a href="https://perlbrew.pl/Release-0.79.html">Release 0.79</a>.&nbsp;</p>
<p>Copy &amp; Paste this line into your terminal:</p>
<pre><code>\curl -L https://install.perlbrew.pl | bash
</code></pre>
<p>Or, if your system does not have curl but something else:</p>
<pre><code># Linux
\wget -O - https://install.perlbrew.pl | bash

# FreeBSD
\fetch -o- https://install.perlbrew.pl | sh
</code></pre>
<p>If you prefer to install with cpan, there are two steps:</p>
<pre><code>sudo cpan App::perlbrew
perlbrew init
</code></pre>
<p>If it is installed with cpan, the perlbrew executable should be installed as&nbsp;<code>/usr/bin/perlbrew</code>&nbsp;or&nbsp;<code>/usr/local/bin/perlbrew</code>. For all users who want to use perlbrew, a prior&nbsp;<code>perlbrew init</code>&nbsp;needs to be executed.</p>
<p>The default perlbrew root directory is&nbsp;<code>~/perl5/perlbrew</code>, which can be changed by setting&nbsp;<code>PERLBREW_ROOT</code>environment variable before the installation and initialization. For more advanced installation process, please read&nbsp;<a href="http://metacpan.org/module/App::perlbrew">the perlbrew document</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://perlbrew.pl/" rel="nofollow">https://perlbrew.pl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44229/common-steps-for-reads-mapping</guid>
	<pubDate>Thu, 09 Mar 2023 02:48:02 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44229/common-steps-for-reads-mapping</link>
	<title><![CDATA[Common steps for reads mapping !]]></title>
	<description><![CDATA[<div><div><div><div><div><div><div><div><div><div><p>Mapping reads to a reference genome is an essential step in many types of genomic analysis, such as variant calling and gene expression analysis. Here are some general steps to follow for mapping reads to a genome:</p><ol>
<li>
<p>Choose a read mapper: There are many read mappers available, such as BWA, Bowtie, and HISAT2. Choose a mapper that is appropriate for your type of data and research question.</p>
</li>
<li>
<p>Index the reference genome: Before mapping reads, the reference genome needs to be indexed. This involves creating an index of the genome sequence that allows the mapper to quickly find matches to the reads. Most mappers have their own indexing tools.</p>
</li>
<li>
<p>Prepare the read data: The reads should be in a format that is compatible with the mapper. Most mappers accept FASTQ or BAM files. Depending on the quality of the data, it may need to be filtered or trimmed before mapping.</p>
</li>
<li>
<p>Run the mapper: The mapper is run with the command-line interface or using a graphical user interface. The specific command depends on the mapper being used, but typically involves specifying the input data, reference genome, and output file format.</p>
</li>
<li>
<p>Evaluate the mapping results: After the mapping is complete, the results should be evaluated. This includes assessing the quality of the mapping, such as the mapping rate, the number of mapped reads, and the mapping quality score.</p>
</li>
<li>
<p>Post-processing: Depending on the analysis being performed, post-processing of the mapped reads may be necessary. This can include filtering reads based on quality, removing duplicate reads, and calling variants.</p>
</li>
</ol><p>Overall, mapping reads to a reference genome is a complex process that requires careful consideration of the type of data, the research question, and the specific mapper being used.</p></div></div></div></div></div></div></div></div></div></div>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36711/ancestral-sequence-reconstruction-steps</guid>
	<pubDate>Fri, 18 May 2018 08:28:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36711/ancestral-sequence-reconstruction-steps</link>
	<title><![CDATA[Ancestral sequence reconstruction steps !]]></title>
	<description><![CDATA[<div><strong>Ancestral sequence reconstruction</strong>&nbsp;(<strong>ASR</strong>) &ndash; also known as&nbsp;<strong>ancestral gene</strong>/<strong>sequence reconstruction</strong>/<strong>resurrection</strong>&nbsp;&ndash; is a technique used in the study of&nbsp;molecular evolution. The method consists of the synthesis of an ancestral&nbsp;gene&nbsp;and expression of the corresponding ancestral&nbsp;protein.&nbsp;<a href="https://en.wikipedia.org/wiki/Ancestral_sequence_reconstruction#cite_note-thornton-1"></a>The idea of protein 'resurrection' was suggested in 1963 by Pauling and Zuckerkandl.<a href="https://en.wikipedia.org/wiki/Ancestral_sequence_reconstruction#cite_note-2"></a>&nbsp;Some early efforts were made in the eighties-nineties, led by the laboratory of&nbsp;Steven A. Benner, showing the potential of this technique &ndash; one that only started to be fulfilled in the post-genomic era.<a href="https://en.wikipedia.org/wiki/Ancestral_sequence_reconstruction#cite_note-3"></a>&nbsp;Thanks to the improvement of algorithms and of better sequencing and synthesis techniques, the method was developed further in the early 2000s to allow the resurrection of a greater variety of and much more ancient genes.<a href="https://en.wikipedia.org/wiki/Ancestral_sequence_reconstruction#cite_note-4"></a>&nbsp;Over the last decade, ancestral protein resurrection has developed as a strategy to reveal the mechanisms and dynamics of protein evolution.&nbsp;</div><div>&nbsp;</div><div>BEAST is the best way to predict the ancestral structure. but, I suggest following steps?</div><div>&nbsp;</div><div>1- Alignments "Mafft -&nbsp;<a href="https://www.researchgate.net/deref/http%3A%2F%2Fmafft.cbrc.jp%2Falignment%2Fsoftware%2Fsource.html" target="_blank">http://mafft.cbrc.jp/alignment/software/source.html</a>"</div><div>mafft --maxiterate 1000 --reorder --thread 24 --genafpair Dataset.fasta &gt; Dataset_Alig.fasta</div><div>&nbsp;</div><div>2- Your dataset has a good phylogenetic signal, is possible to perform with Tree-Puzzle "<a href="https://www.researchgate.net/deref/http%3A%2F%2Fwww.tree-puzzle.de" target="_blank">http://www.tree-puzzle.de</a>";</div><div>&nbsp;</div><div id="yui_3_14_1_1_1526649596608_1443">3 - This dataset which the saturation index, I perform with "<a href="https://www.researchgate.net/deref/http%3A%2F%2Fdambe.bio.uottawa.ca%2Fdambe.asp" target="_blank">http://dambe.bio.uottawa.ca/dambe.asp</a>";</div><div>&nbsp;</div><div>4- Has evidence of possible recombination in your dataset, the evaluate if this presence or absence, because this may to influence the grouping of clades, I perform with</div><div>---recombination</div><div>&nbsp;</div><div>4.1- Phi-test, implemented in SplitTree4"<a href="https://www.researchgate.net/deref/http%3A%2F%2Fwww.splitstree.org" target="_blank">http://www.splitstree.org</a>", (.nex file)</div><div>&nbsp;</div><div>4.2- GARD deployed in webserver in the DataMonkey "<a href="https://www.researchgate.net/deref/http%3A%2F%2Fwww.datamonkey.org%2F" target="_blank">http://www.datamonkey.org/</a>" - turning to the amino acid seaview -&gt; view proteins -&gt; save as ...) Ideally do a tree-based groups.</div><div>&nbsp;</div><div>4.3- RDP4 for download and installation on Windows in "<a href="https://www.researchgate.net/deref/http%3A%2F%2Fweb.cbio.uct.ac.za%2F~darren%2Frdp.html" target="_blank">http://web.cbio.uct.ac.za/~darren/rdp.html</a>"</div><div>&nbsp;</div><div>4.4- Hyphy (Mac, Windows, Linux) in "<a href="https://www.researchgate.net/deref/http%3A%2F%2Fhyphy.org%2Fw%2Findex.php%2FDownload" target="_blank">http://hyphy.org/w/index.php/Download</a>"</div><div>&nbsp;</div><div>4.5- Path-o-Gen (temporal structure of a tree input file -&gt; arquivo.tre)</div><div>These steps above, I call of pre-processing to inferences phylogenetic...</div><div>&nbsp;</div><div>5- Perform phylogenetic tree, used Bayesian Inference with Molecular Clock, but is necessary Clock Testing:</div><div>&nbsp;</div><div>- This step is performed with program Beast (Beauti, Beast and TreeAnnotator), and Tracer_v1.5 more FigTree to inspection.</div><div>&nbsp;</div><div>- Tutorials:&nbsp;<a href="https://www.researchgate.net/deref/http%3A%2F%2Fbeast.bio.ed.ac.uk%2Ftutorials" target="_blank">http://beast.bio.ed.ac.uk/tutorials</a></div><div>- Downloads:&nbsp;<a href="https://www.researchgate.net/deref/http%3A%2F%2Fbeast.bio.ed.ac.uk%2Fdownloads" target="_blank">http://beast.bio.ed.ac.uk/downloads</a></div>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>

</channel>
</rss>