Address of the bookmark: http://seq.crg.es/download/software/Miro/

Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump (http://www.ncbi.nlm.nih.gov/pubmed/26109056), and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.

Address of the bookmark: https://ncbi.github.io/magicblast/

In this project, you will use single-molecule techniques to label mRNA and DNA in (live and fixed) Drosophila embryos and fixed embryonic bodies. You will also use super-resolution microscopy to visualize protein condensates. Co-localization dynamics reflecting DNA-protein bindings and DNA looping events will be detected, analyzed, and used to test computational models of gene transcription.

Qualification:
MSc degree (or equivalent) in Biology, Biophysics, or Bioengineering

Experience in one or more of these areas: (1) molecular cloning, (2) imaging, (3) image analysis (using Matlab/Python/Java), (4) microfluidics, and (5) computational modeling.

How to Apply?
Send (1) your CV, (2) summary of research experience, and (3) email addresses of at least 2 references to ezzat.el-sherif@fau.de. Title your email ‘Transcription PhD Position’.

salary Grade.: E13
Total Time: 3 Jahre
Start: 01.01.2020.
End: 31.3.2020.

Address:
Dr. El-Sherif, Ezzat
Department Biologie
Professur für Zoologie (Entwicklungsbiologie) (Prof. Dr. Klingler)
Telefon 09131/85-28068, Fax 09131/85-28040, E-Mail: ezzat.el-sherif@fau.de

Protein-protein and protein-DNA/RNA docking based on a hybrid algorithm of template-based modeling and ab initio free docking.

The HDOCK server distinguishes itself from similar docking servers in its ability to support amino acid sequences as input and a hybrid docking strategy in which experimental information about the protein–protein binding site and small-angle X-ray scattering can be incorporated during the docking and post-docking processes.

Address of the bookmark: http://hdock.phys.hust.edu.cn/

Key Components

1. Sample Collection: Meta-transcriptomics begins with the collection of environmental samples. These samples are often complex, containing a wide range of microorganisms.

2. RNA Extraction: RNA is extracted from the sample, which includes mRNA, rRNA, tRNA, and other non-coding RNAs. This step is crucial as it determines the quality and representativeness of the data.

3. Sequencing: High-throughput RNA sequencing (RNA-seq) technologies are used to obtain sequences of the RNA transcripts. This step provides a vast amount of data on the RNA molecules present in the sample.

4. Data Analysis: Computational tools and bioinformatics methods are employed to process and analyze the sequencing data. This involves mapping RNA sequences to reference genomes or transcriptomes, identifying expressed genes, and quantifying their abundance.

5. Functional Annotation: The functional roles of identified transcripts are inferred based on known gene functions, allowing researchers to understand the metabolic and ecological functions of the microbial community.

Applications

1. Environmental Monitoring: Meta-transcriptomics can be used to monitor the health and functional status of ecosystems. For example, it can help assess the impact of pollution on microbial communities by revealing changes in gene expression related to stress response and degradation processes.

2. Microbiome Research: In human health, meta-transcriptomics offers insights into the gut microbiome’s functional state. It helps in understanding how microbial communities interact with their host, how they respond to dietary changes, and their role in health and disease.

3. Biotechnology: The technique can aid in the discovery of novel enzymes and bioactive compounds by profiling microbial communities in extreme environments or industrial processes.

4. Disease Pathogenesis: By analyzing RNA profiles from disease-associated environments, researchers can uncover pathogen-host interactions and identify potential targets for therapeutic interventions.

Challenges

1. Complexity of Data: The sheer volume and complexity of data generated by meta-transcriptomics can be overwhelming. Effective data management and advanced computational tools are required to extract meaningful insights.

2. Sampling Bias: Environmental samples can be heterogeneous, and RNA extraction methods may introduce biases, potentially affecting the accuracy of the results.

3. Reference Databases: Incomplete or biased reference databases can hinder the accurate functional annotation of transcripts, especially when studying novel or poorly characterized organisms.

Future Directions

Meta-transcriptomics is a rapidly evolving field, with ongoing advancements in sequencing technologies and bioinformatics. Future research may focus on improving data integration, developing more comprehensive reference databases, and enhancing our understanding of microbial community dynamics in various environments. As these challenges are addressed, meta-transcriptomics will continue to provide valuable insights into the functional roles of microorganisms and their interactions within ecosystems.

Conclusion

Meta-transcriptomics represents a powerful tool for exploring the functional aspects of microbial communities in their natural environments. By capturing a snapshot of gene expression and metabolic activities, this approach offers a deeper understanding of ecological interactions, health implications, and biotechnological potentials. As technology and methodologies advance, meta-transcriptomics is poised to make significant contributions to our knowledge of the microbial world.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Address of the bookmark: http://samtools.sourceforge.net/swlist.shtml

(1) they enable exploration of hypotheses, and as such, have become invaluable means to guide research;

(2) they are unique approaches to integrate (in the literal term of the word) biological knowledge, in the form of experimental results; and

(3) they enable connecting biology with other fields of study ranging from physiology to genomics;

This blog, and this software list, is intended to guide the potential user of simulation models.
It is not, in any way, meant to be comprehensive on the very diverse simulation tools that already exist, but focuses on mechanistic, dynamic models. Similarly, it is not meant to provide any coverage of the breadth of applications; however, for interested readers, we provide references to use as a possible starting point.

Simulation models are meant to answer questions which scientists have in a dynamic, quantitative, and often, a pictorial way. Much of the bioinformatics research and its applications, in particular, involve a large number of components, actors, and factors. Assembling these in a coherent framework may seem a daunting task, especially for beginners, and can lead to confusion, even for experienced scientists, especially if the objectives of such an exercise are not well defined. Followings are the list of tools bioinformatician may use to analyze and provide answers to complex biological mechanisms and related problems.

In the mid 1960's scientists discovered that many genomes contain stretches of highly repetitive DNA sequences ( see Reassociation Kinetics Experiments, and C-Value Paradox ). These sequences were later characterized and placed into five categories:

Simple Repeats - Duplications of simple sets of DNA bases (typically 1-5bp) such as A, CA, CGG etc.
Tandem Repeats - Typically found at the centromeres and telomeres of chromosomes these are duplications of more complex 100-200 base sequences.
Segmental Duplications - Large blocks of 10-300 kilobases which are that have been copied to another region of the genome.
Interspersed Repeats
Processed Pseudogenes, Retrotranscripts, SINES - Non-functional copies of RNA genes which have been reintegrated into the genome with the assitance of a reverse transcriptase.
DNA Transposons
Retrovirus Retrotransposons
Non-Retrovirus Retrotransposons ( LINES )

Currently up to 50% of the human genome is repetitive in nature and as improvements are made in detection methods this number is expected to increase.

On the other hand; In genetics, the term palindrome refers to a sequence of nucleotides along a DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) strand that contains the same series of nitrogenous bases regardless from which direction the strand is analyzed. Akin to a language palindrome—wherein a word or phrase is spelled the same left-to-right as right-to-left (e.g., the word RADAR or the phrase "able was I ere I saw elba")—with genetic palindromes it does not matter whether the nucleic acid strand is read starting from the 3' (three prime) end or the 5' (five prime) end of the strand.

Recent research on palindromes centers on understanding palindrome formation during gene amplification. Other studies have attempted to relate palindrome formation to molecular mechanisms involved in double stranded breaks and in the formation of inverted repeats. Assisted by high speed computers, other groups of scientists link palindrome formation to the conservation of genetic information.

Related to the direction of transcription by RNA polymerase, DNA strands have upstream and downstream terminus defined by differing chemical groups at each end. The ends of each strand of DNA or RNA are termed the 5' (phosphate bound to the 5' position carbon) and 3' (phosphate bound to the 3' carbon) ends to indicate a polarity within the molecule. Using the letters A, T, C, G, to represent the nitrogenous bases adenine, thymine, cytosine, and guanine found in DNA, and the letters A, U, C, G to represent the nitrogenous bases adenine, uracil, cytosine, guanine found in RNA (Note that uracil in RNA replaces the thymine found in DNA), geneticists usually represent DNA by a series of base codes (e.g., 5' AATCGGATTGCA 3'). The base codes are usually arranged from the 5' end to the 3' end.

Because of specific base pairing in DNA (i.e., adenine (A) always bonds with (thymine (T) and cytosine (C) always bonds with guanine (G)) the complimentary stand to the sequence 5' AATCGGATTGCA 3' would be 3' TTAGCCTAACGT 5'.

With palindromes the sequences on the complimentary strands read the same in either direction. For example, a sequence of 5' GAATTC3' on one strand would be complimented by a 3' CTTAAG 5' strand. In either case, when either strand is read from the 5' prime end the sequence is GAATTC. Another example of a palindrome would be the sequence 5' CGAAGC 3' that, when reversed, still reads CGAAGC.

Palindromes are important sequences within nucleic acids. Often they are the site of binding for specific enzymes (e.g., restriction endobucleases) designed to cut the DNA strands at specific locations (i.e., at palindromes).

Palindromes may arise from brakeage and chromosomal inversions that form inverted repeats that compliment each other. When a palindrome results from an inversion, it is often referred to as an inverted repeat. For example, the sequence 5' CGAAGC 3', if inverted (reversed 180°), still reads CGAAGC.

The European Molecular Biology Open Software Suite (EMBOSS) includes some basic tools for finding tandem repeats and inverted repeats (see B.6.22. Applications in group Nucleic:repeats). There are many on-line services providing the EMBOSS tools, for example:

• Wageningen Bioinformatics Webportal EMBOSS explorer
• Mobyle@Pasteur
• Soaplab2 Web Services at Vital-IT

For more sophisticated repeat finding you will want to look at tools using Repbase for example:

• CENSOR
  • CENSOR@GIRI
  • CENSOR@EMBL-EBI
• RepeatMasker
• MUMmer (scan_for_match)
• Emboss Palindrome

Other nucleotide repeat finding methods found by a couple of web searches:

• Tandem Repeats Finder
• RECON
• RepeatRunner
• REPuter
• Imperfect Microsatellite Extractor (IMEx)
• Spectral Repeat Finder (SRF)
• REPFIND
• CRISPRfinder
• GrailEXP
• CONREPP
• find_palindromes
• Palindrome
• EMBOSS Palindrome
• Palindrome Search