http://elements.eaglegenomics.com/

A fairly complete on-line guide to BLAST searching can be found at the NCBI BLAST Help Manual. For a theoretical overview of BLAST, see the NCBI BLAST Course. Additional information can be found in the BLAST 2.0 Release Notes

Supported and Suggested Values for Gap Open and Extension in BLASTP, BLASTX, TBLASTN, and TBLASTX

Address of the bookmark: https://www.arabidopsis.org/Blast/BLASToptions.jsp

Check out the changes they made.

They added the cleanup-blastdb-volumes.py script to remove unused BLAST database volumes. Read the documentation here.

They also switched the protocol from ftp to https to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the update_blastdb.pl script.

And fixed a few bugs related to downloading data from the NCBI, and mt_mode crashing blastn and blastx.

Check out the release notes.

Download BLAST+ 2.14.1

Questions or comments? Please write the BLAST help desk.

More info and download: https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

Address of the bookmark: https://github.com/elswob/SCUBAT

• Updated human gene set (GENCODE 21)
• Updated rat gene set including manual annotation from HAVANA
• New species: Vervet-African green monkey
• Imported Transcript Support Levels (TSLs) from UCSC for human and mouse
• Imported APPRIS flag for human and mouse
• Updated Amazon molly gene set

Find more at http://www.ensembl.info/blog/2014/10/02/ensembl-77-has-been-released/

For the full list of features, improvements and fixes, see the release notes:https://ncbi.nlm.nih.gov/tools/gbench/releasenotes

New Features

• BLAST Tool: added support for local custom BLAST databases
• Graphical Sequence View: added log scaling option for graph tracks
• Generic Table View: new tutorial added

Bug Fixes and Improvements

• Project Tree View: Genomic Collections/Assemblies now show accessions, not just names
• Tree View: layout updated to better accommodate nodes of different sizes
• Table Import Dialog (MacOS): fixed issue with table visibility
• Fixed bug where different molecules IDs in GenBank could resolve to the same sequence
• Graphical Sequence View: fixed issue where sequence track was not shown for some sequences
• Graphical Sequence View: fixed protein coloration methods
• Graphical Sequence View: improved rendering of Markers to better indicate boundaries and produce higher quality PDF images
• Create Gene Model tool: fixed scenario when gene model tool failed with local sequences
• Search View: ORF Finder – fixed incorrect protein lengths
• Fixed bug with not opening project file (.gbp) on a click
• Fixed issues in GVF import
• Fixed BLAST Search tool against NCBI databases not working
• Fixed tblastn (protein BLAST) not working in standalone mode
• Fixed GTF export failure

More at file:///home/urbe/Downloads/diamond_manual.pdf

http://www.nature.com/nmeth/journal/v12/n1/full/nmeth.3176.html

Address of the bookmark: https://github.com/bbuchfink/diamond

The changes in nr preserve the taxonomic diversity of the entries in the database while reducing the number of titles for identical sequences. GenPept accessions are still accessible via www.ncbi.nlm.nih.gov/protein/$GENBANK_ACCESSION or the IPG website https://www.ncbi.nlm.nih.gov/ipg/.

The "Identical Proteins" link in the alignments section of the webBLAST results takes you to a full list of all accessions associated with a sequence.

For BLAST+ users downloading nr_v5: the database is now approximately 50% smaller, resulting in faster downloads and BLAST searches, and smaller disk space requirements. The database is downloadable at:  ftp://ftp.ncbi.nlm.nih.gov/blast/db/v5/

For BLAST+ there is a cleanup script to help you manage the transition to this smaller database. The script removes unused database volumes: ftp://ftp.ncbi.nlm.nih.gov/blast/temp/cleanup-blastdb-volumes.py

Here are the new rules on how we keep titles in nr_v5:

1.    We keep all refseq, swissprot, pir and PDB titles.

2.    We keep any GenPept titles with a TAXID that has not already been seen in the record.

3.    We keep at least five GenPept titles regardless of whether the TAXIDS have been seen before or not in this record.