BOL: Related items

R Graphs !!

Jit — Fri, 04 Nov 2016 10:48:00 -0500

The blog is a collection of script examples with example data and output plots. R produce excellent quality graphs for data analysis, science and business presentation, publications and other purposes. Self-help codes and examples are provided. Enjoy nice graphs !!

Address of the bookmark: http://rgraphgallery.blogspot.be/

GoJS

Jit — Tue, 22 Nov 2016 08:25:37 -0600

GoJS is a feature-rich JavaScript library for implementing custom interactive diagrams and complex visualizations across modern web browsers and platforms. GoJS makes constructing JavaScript diagrams of complex nodes, links, and groups easy with customizable templates and layouts.

GoJS offers many advanced features for user interactivity such as drag-and-drop, copy-and-paste, in-place text editing, tooltips, context menus, automatic layouts, templates, data binding and models, transactional state and undo management, palettes, overviews, event handlers, commands, and an extensible tool system for custom operations.

GoJS is pure JavaScript, so users get interactivity without requiring round-trips to servers and without plugins. GoJS normally runs completely in the browser, rendering to an HTML5 Canvas element or SVG without any server-side requirements. GoJS does not depend on any JavaScript libraries or frameworks, so it should work with any HTML or JavaScript framework or with no framework at all.

More at http://gojs.net/latest/index.html

Address of the bookmark: http://gojs.net/latest/index.html

odgi: optimized dynamic genome/graph implementation

Abhimanyu Singh — Tue, 01 Feb 2022 23:42:21 -0600

odgi provides an efficient and succinct dynamic DNA sequence graph model, as well as a host of algorithms that allow the use of such graphs in bioinformatic analyses.

Careful encoding of graph entities allows odgi to efficiently compute and transform pangenomes with minimal overheads. odgi implements a dynamic data structure that leveraged multi-core CPUs and can be updated on the fly.

The edges and path steps are recorded as deltas between the current node id and the target node id, where the node id corresponds to the rank in the global array of nodes. Graphs built from biological data sets tend to have local partial order and, when sorted, the deltas be small. This allows them to be compressed with a variable length integer representation, resulting in a small in-memory footprint at the cost of packing and unpacking.

The RAM and computational savings are substantial. In partially ordered regions of the graph, most deltas will require only a single byte.

Address of the bookmark: https://github.com/pangenome/odgi

Krona

Jit — Wed, 22 Mar 2017 04:47:35 -0500

Krona allows hierarchical data to be explored with zooming, multi-layered pie charts. Krona charts can be created using an Excel template or KronaTools, which includes support for several bioinformatics tools and raw data formats. The interactive charts are self-contained and can be viewed with any modern web browser (see Browser support).

Address of the bookmark: https://github.com/marbl/Krona/wiki

VG: variation graph data structures, interchange formats, alignment, genotyping, and variant calling methods

Jit — Tue, 28 Jan 2020 03:53:24 -0600

Variation graphs provide a succinct encoding of the sequences of many genomes. A variation graph (in particular as implemented in vg) is composed of:

nodes, which are labeled by sequences and ids
edges, which connect two nodes via either of their respective ends
paths, describe genomes, sequence alignments, and annotations (such as gene models and transcripts) as walks through nodes connected by edges

Address of the bookmark: https://github.com/vgteam/vg

Graph Genome Suite

Jit — Fri, 28 Oct 2016 07:59:54 -0500

Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the Graph Genome Suite — the most advanced population genomics tools in the world.

Address of the bookmark: https://www.sbgenomics.com/graph/

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph

Jit — Wed, 14 Nov 2018 04:50:27 -0600

MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accelerated version of MEGAHIT has been tested on NVIDIA GTX680 (4G memory) and Tesla K40c (12G memory) with CUDA 5.5, 6.0 and 6.5. MEGAHIT v1.0 or greater also supports IBM Power PC and has been tested on IBM POWER8.

https://academic.oup.com/bioinformatics/article/31/10/1674/177884

Address of the bookmark: https://github.com/voutcn/megahit

GraphUnzip: Phases an assembly graph using Hi-C data and/or long reads.

Jit — Fri, 05 Feb 2021 21:22:24 -0600

GraphUnzip, a fast, memory-efficient and accurate tool to unzip assembly graphs into their constituent haplotypes using long reads and/or Hi-C data. As GraphUnzip only connects sequences in the assembly graph that already had a potential link based on overlaps, it yields high-quality gap-less supercontigs. To demonstrate the efficiency of GraphUnzip, we tested it on a simulated diploid Escherichia coli genome, and on two real datasets for the genomes of the rotifer Adineta vaga and the potato Solanum tuberosum. In all cases, GraphUnzip yielded highly continuous phased assemblies.

https://www.biorxiv.org/content/biorxiv/early/2021/02/01/2021.01.29.428779.full.pdf

Address of the bookmark: https://github.com/nadegeguiglielmoni/GraphUnzip