• nodes, which are labeled by sequences and ids
• edges, which connect two nodes via either of their respective ends
• paths, describe genomes, sequence alignments, and annotations (such as gene models and transcripts) as walks through nodes connected by edges

Address of the bookmark: https://github.com/vgteam/vg

Address of the bookmark: http://rgraphgallery.blogspot.be/

GoJS offers many advanced features for user interactivity such as drag-and-drop, copy-and-paste, in-place text editing, tooltips, context menus, automatic layouts, templates, data binding and models, transactional state and undo management, palettes, overviews, event handlers, commands, and an extensible tool system for custom operations.

GoJS is pure JavaScript, so users get interactivity without requiring round-trips to servers and without plugins. GoJS normally runs completely in the browser, rendering to an HTML5 Canvas element or SVG without any server-side requirements. GoJS does not depend on any JavaScript libraries or frameworks, so it should work with any HTML or JavaScript framework or with no framework at all.          

More at http://gojs.net/latest/index.html

Address of the bookmark: http://gojs.net/latest/index.html

You might learn a lot about that house—the rooms, the doors, the furniture—but you would miss the bigger story: the streets, the neighborhoods, and all the ways the city changes from one place to another.

Something similar happens when scientists study bacterial genomes one at a time.

Over the past decade, researchers have collected thousands of bacterial genomes. These genomes contain an enormous amount of information about how bacteria survive, adapt, and evolve. But comparing thousands of individual genomes can quickly become a computational maze.

That is where PANORAMA enters the story.

Developed by Jérôme Arnoux and colleagues, PANORAMA is a computational tool designed to explore bacterial pangenomes—the complete collection of genetic possibilities found across a species or group of related organisms. Instead of looking at every genome as an isolated object, the approach represents their shared and variable genetic features as a graph.

Think of this graph as a giant subway map.

Some stations appear on almost every route. These represent genes that are highly conserved. Other stations appear only on certain routes, representing genes that some bacteria possess while others do not. By looking at the entire network, scientists can begin to see not just *what genes exist*, but how they are organized and how biological systems are distributed across populations.

The researchers put PANORAMA to the test using 941 genomes of Pseudomonas aeruginosa, a bacterium important in human health. They used the tool to investigate biological systems, including bacterial defense mechanisms against viruses known as bacteriophages. They then expanded the analysis to more than 6,000 genomes from four Enterobacteriaceae species.

The result is more than a faster way to process data.

PANORAMA allows researchers to ask a bigger question: What can an entire microbial species do, genetically speaking?

By comparing pangenomes, the researchers could identify systems shared between species as well as distinctive features. They could also find recurring genomic locations where genetic material is inserted—clues that may reveal common evolutionary processes.

And this is perhaps the most exciting part of the story.

Every bacterial genome is like a page in a huge evolutionary book. Until recently, reading thousands of those pages together was difficult. PANORAMA provides a way to turn those pages into a map, allowing scientists to see patterns that might disappear when each genome is studied separately.

The study, published in PLOS Computational Biology in July 2026, presents PANORAMA as a foundation for large-scale comparative pangenomics. The software and accompanying analysis resources are openly available, giving other researchers the opportunity to explore microbial diversity themselves.

So the story is not really about one bacterium or one genome.

It is about changing the way we look at life.

Instead of asking, “What is inside this genome?”, scientists can increasingly ask, “What is the full genetic landscape of this species—and how did it become this way?”

And sometimes, when you stop looking at one house and finally see the whole city, the most interesting discoveries are hiding in the streets between them.

Read more at https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1013856

Address of the bookmark: https://github.com/marbl/Krona/wiki

Careful encoding of graph entities allows odgi to efficiently compute and transform pangenomes with minimal overheads. odgi implements a dynamic data structure that leveraged multi-core CPUs and can be updated on the fly.

The edges and path steps are recorded as deltas between the current node id and the target node id, where the node id corresponds to the rank in the global array of nodes. Graphs built from biological data sets tend to have local partial order and, when sorted, the deltas be small. This allows them to be compressed with a variable length integer representation, resulting in a small in-memory footprint at the cost of packing and unpacking.

The RAM and computational savings are substantial. In partially ordered regions of the graph, most deltas will require only a single byte.

Address of the bookmark: https://github.com/pangenome/odgi

Address of the bookmark: https://www.sbgenomics.com/graph/

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia