<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44279?offset=10</link>
	<atom:link href="https://bioinformaticsonline.com/related/44279?offset=10" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/21685/uiar-short-term-trainingfinal-year-dissertation-project-in-life-sciencesbioinformaticsbiotech</guid>
  <pubDate>Mon, 16 Mar 2015 23:56:25 -0500</pubDate>
  <link></link>
  <title><![CDATA[UIAR Short-Term Training/Final Year Dissertation Project in Life Sciences/Bioinformatics/Biotech]]></title>
  <description><![CDATA[
<p>Short-term training/Final year dissertation project</p>

<p>Candidates desirous of doing a short-term training / final year dissertation project for MSc (Life Sciences/Bioinformatics/Biotechnology or any science discipline) at UIAR Biophysics and Bioinformatics department may please drop an email atanju@iiar.res.in along with their resume.</p>

<p>Selected candidates will be further intimated. There will be a fees charged for doing the project at UIAR. The projects will be experimental or computational or involve both.</p>

<p>The training scope will be in the following areas but not limited to:</p>

<p>Bioinformatics analysis, Docking and Virtual screening, Molecular Dynamics simulation, Cloning, expression and purification of proteins, Biophysical and Biochemical characterisation of proteins, Crystallization and Structural Studies.</p>

<p>Advertisement: www.iiar.res.in/?q=node/450</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/24178/essentials-of-statistics-and-data-analysis-using-r</guid>
  <pubDate>Mon, 31 Aug 2015 01:32:12 -0500</pubDate>
  <link></link>
  <title><![CDATA[Essentials of Statistics and Data Analysis using R]]></title>
  <description><![CDATA[
<p>Clinical Development Services Agency (CDSA) is an extramural unit of Translational Health Science and Technology Institute (THSTI), Department of Biotechnology, Ministry of Science &amp; Technology, Government of India. CDSA has a national mandate of strengthening capacity and capability building in the area of Clinical development and Translational Research.</p>

<p>CDSA is pleased to announce a 4 days hands-on training program on “Essentials of Statistics and Data Analysis using R” at ICGEB, Aruna Asaf Ali Road, New Delhi on December 1 – 4, 2015. This will involve developing and enhancing skills to understand basic principles of statistics for summarizing data and use of appropriate statistical tests as well as providing an understanding of data analysis using R. Didactic lectures with practical sessions will be delivered by experienced faculties from AIIMS and Novartis. Live classroom with power point presentations, case studies, mock exercise, practical sessions on R, group work with time for discussion and Q&amp;A sessions are added advantages of this workshop.</p>

<p>Please contact gayatrivishwakarma.cdsa@thsti.res.in or vineetabaloni.cdsa@thsti.res.in for program and registration details.</p>

<p>Please nominate personage or register yourself on or before November 6, 2015 along with the electronic transfer of registration fee.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27463/bpipe-a-tool-for-running-and-managing-bioinformatics-pipelines</guid>
	<pubDate>Sat, 21 May 2016 22:42:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27463/bpipe-a-tool-for-running-and-managing-bioinformatics-pipelines</link>
	<title><![CDATA[Bpipe - a tool for running and managing bioinformatics pipelines]]></title>
	<description><![CDATA[<p>Bpipe provides a platform for running big bioinformatics jobs that consist of a series of processing stages - known as 'pipelines'.</p>
<ul>
<li>January 20th, 2016 - New! Bpipe 0.9.9 released!</li>
<li>Download <a href="http://download.bpipe.org/versions/bpipe-0.9.9.tar.gz">latest</a>, <a href="http://download.bpipe.org">all</a></li>
<li><a href="http://docs.bpipe.org">Documentation</a></li>
<li><a href="https://groups.google.com/forum/#%21forum/bpipe-discuss">Mailing List</a> (Google Group)</li>
</ul>
<p>Bpipe has been published in <a href="http://bioinformatics.oxfordjournals.org/content/early/2012/04/11/bioinformatics.bts167.abstract">Bioinformatics</a>! If you use Bpipe, please cite:</p>
<p><em>Sadedin S, Pope B &amp; Oshlack A, Bpipe: A Tool for Running and Managing Bioinformatics Pipelines, Bioinformatics</em></p><p>Address of the bookmark: <a href="http://docs.bpipe.org/" rel="nofollow">http://docs.bpipe.org/</a></p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42672/introduction-to-bioinformatics-and-computational-biology</guid>
	<pubDate>Mon, 25 Jan 2021 01:32:30 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42672/introduction-to-bioinformatics-and-computational-biology</link>
	<title><![CDATA[Introduction to Bioinformatics and Computational Biology]]></title>
	<description><![CDATA[<p><span>This is the course material for STAT115/215 BIO/BST282 at Harvard University.</span></p>
<p>Xiaole Shirley Liu (lead instructor)<br>Joshua Starmer<br>Martin Hemberg<br>Ting Wang<br>Feng Yue</p>
<p>Ming Tang<br>Yang Liu<br>Jack Kang<br>Scarlett Ge<br>Jiazhen Rong<br>Phillip Nicol<br>Maartin De Vries</p>
<p>We thank many colleagues in the community, who helped Dr.&nbsp;Liu in prepare the STAT115/215 BIO/BST282 course over the years.&nbsp;</p><p>Address of the bookmark: <a href="https://liulab-dfci.github.io/bioinfo-combio/" rel="nofollow">https://liulab-dfci.github.io/bioinfo-combio/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/42809/bioinformatics-in-africa-part2-kenya</guid>
	<pubDate>Sat, 06 Feb 2021 13:23:54 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/42809/bioinformatics-in-africa-part2-kenya</link>
	<title><![CDATA[Bioinformatics in Africa: Part2 - Kenya]]></title>
	<description><![CDATA[<p>International Livestock Research Institute (ILRI):</p><p>Under&nbsp; &nbsp;a&nbsp; &nbsp;NEPAD&nbsp; &nbsp;initiative,&nbsp; &nbsp;the&nbsp; &nbsp;Biosciences&nbsp; &nbsp;Eastern&nbsp; &nbsp;and&nbsp; &nbsp;Central&nbsp; &nbsp;Africa&nbsp; &nbsp;(BECA)&nbsp; (www.biosciencesafrica.org) was established at ILRI. BECA consists of a hub, regional nodes, and&nbsp; other affiliated laboratories and partner institutes. A state of the art joint Bioinformatics Platform&nbsp; (www.becabioinfo.org), whose overall goal is to provide a coherent and powerful bioinformatics&nbsp; infrastructure for use by all scientists in East and central Africa. The Platform goal requires both&nbsp; physical and intellectual developments that together provide researchers with access to diverse&nbsp; infrastructure in a wide&shy;area network, thereby addressing four important aspects of bioinformatics:&nbsp;</p><p>1) Science: bioinformatics tools for data integration and visualization, standardization of data&nbsp; formats and data analysis strategies, and distribution of analysis tasks over local&shy; and widearea networks are in development;&nbsp;</p><p>2)&nbsp; Bioinformatics Support Facility: provides assistance and custom programming to projects&nbsp; and those unable to establish a bioinformatics support function intrinsic to their project due&nbsp; to shortage of qualified personnel or lack of funding;&nbsp;</p><p>3) Hardware Platform: provide a powerful high performance computing platform capable of&nbsp; handling the largest analysis needs for projects;&nbsp;</p><p>4) Bioinformatics Training for East and central African scientists: While many Web&shy;based&nbsp; tools are available to the wet&shy;lab researcher, the Web is not well suited for tasks beyond&nbsp; single&shy;sequence annotation. Researchers need to become productive in a server&shy;based Unix&nbsp; environment with its wealth of scripting and automation tools. Even at an entry&shy;level, this&nbsp; can be an intimidating task if proper guidance is not available.</p><p>International&nbsp;Centre&nbsp;of&nbsp;Insect&nbsp;Physiology&nbsp;and&nbsp;Ecology&nbsp;(ICIPE): ICIPE&rsquo;s&nbsp;research&nbsp;focus&nbsp;is&nbsp;on&nbsp;insect&nbsp;biology,&nbsp;in&nbsp;order&nbsp;to&nbsp;improve&nbsp;the&nbsp;wellbeing&nbsp;of&nbsp;the&nbsp;peoples&nbsp;of&nbsp;the&nbsp; tropics&nbsp;through&nbsp;insect&nbsp;science.&nbsp;There&nbsp;is&nbsp;a&nbsp;commitment&nbsp;to&nbsp;utilise&nbsp;contemporary&nbsp;science&nbsp;in&nbsp;order&nbsp;to&nbsp; limit&nbsp;the&nbsp;impact&nbsp;of&nbsp;disease&nbsp;vectors,&nbsp;and&nbsp;agricultural&nbsp;pests.&nbsp;The&nbsp;understanding&nbsp;of&nbsp;the&nbsp;mechanisms&nbsp; associated&nbsp;with&nbsp;behaviour&nbsp;(e.g.&nbsp;attraction&nbsp;and&nbsp;repellency)&nbsp;is&nbsp;crucial.&nbsp;ICIPE&nbsp;seeks&nbsp;to&nbsp;enhance&nbsp;its&nbsp; bioinformatics&nbsp;capacity&nbsp;in&nbsp;order&nbsp;to&nbsp;support&nbsp;data&nbsp;from&nbsp;various&nbsp;EST&nbsp;projects&nbsp;designed&nbsp;to&nbsp;gain&nbsp;insights&nbsp; into&nbsp;the&nbsp;insect&nbsp;ecology&nbsp;and&nbsp;plant&nbsp;pathogen&nbsp;interactions&nbsp;though&nbsp;studies&nbsp;of&nbsp;metabolic&nbsp;pathways&nbsp; associated&nbsp;with&nbsp;production&nbsp;of&nbsp;all&nbsp;elochemicals.&nbsp;</p><p>Long&shy;term training activities:</p><p>Kenyatta University: An introductory course in Bioinformatics is offers to MSc Biotechnology&nbsp; students. This comprises of 35 hours of lectures and practicals.</p><p>University of Nairobi: A centre for Biotechnology and Bioinformatics (CEBIB), which will offer&nbsp; postgraduate training (diplomas, MSc and PhD) in areas of biotechnology and bioinformatics has&nbsp; recently been launched. Other universities in Kenya, including Egerton, Maseno and the Jomo Kenyatta University of&nbsp; Agriculture and Technology offer introductory courses to undergraduates in biomedical sciences. In addition, under the BECA platform MSc and PhD fellowships are being made available for&nbsp; Bioinformatics students. ILRI is forging links with Universities in South Africa and the United&nbsp; Kingdom to provide access to courses and training material.&nbsp;</p><p>Research Interest and Activities:</p><p>The following are the present areas of research interest: 1. EST clustering 2. Genome sequencing and annotation 3. Functional genomics and proteomics (including key tropical pathogens) 4. Structural bioinformatics 5. Development of Bioinformatics Data Management Systems 6. Gene Mining 7. High Throughput Genotyping 8. Microarray data management and analysis 9. Metagenomics 10. Immunoinformatics 11. Host&shy;pathogen interaction 12. High performance computing and grid development 13. Parasite transfection technologies 14. Cell cycle regulation 15. Population genetics 16. Vector genomics 17. Drug, vaccine and diagnostic target discovery</p><p>More at&nbsp;Web&nbsp;site&nbsp;and&nbsp;links:</p><p>http://www.ilri.cgiar.org/</p><p>http://www.icipe.org/ &nbsp; &nbsp;</p><p>http://www.uonbi.ac.ke/cebib</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/43272/bioinformatics-head-bioinformatics-manager-iii-cancer-genomics-research-laboratory-at-frederick-national-laboratory</guid>
  <pubDate>Wed, 18 Aug 2021 00:19:48 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatics Head (Bioinformatics Manager III), Cancer Genomics Research Laboratory at  Frederick National Laboratory]]></title>
  <description><![CDATA[
<p>Frederick National Laboratory seeking an enthusiastic, creative, and seasoned bioinformatics professional to join our leadership team and direct the exceptional Bioinformatics Group at the Cancer Genomics Research Laboratory (CGR).  CGR has a diverse team of bioinformatics and computational scientists that support all areas of bioinformatics and data analysis (infrastructure, data QC, pipeline development and maintenance, data curation and sharing, methodology development, statistical analyses, machine learning approaches, and scientific interpretation).</p>

<p>More at https://leidosbiomed.csod.com/ats/careersite/jobdetails.aspx?site=4&amp;c=leidosbiomed&amp;id=2040</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44204/bioinformatics-training-collections</guid>
	<pubDate>Sun, 05 Mar 2023 23:01:26 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44204/bioinformatics-training-collections</link>
	<title><![CDATA[Bioinformatics Training Collections !]]></title>
	<description><![CDATA[<p>Useful list of bioinformatics training collections @&nbsp;https://github.com/sib-swiss/training-collection</p><p>Address of the bookmark: <a href="https://github.com/sib-swiss/training-collection" rel="nofollow">https://github.com/sib-swiss/training-collection</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/23516/visual-machine-learning</guid>
	<pubDate>Wed, 29 Jul 2015 04:29:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/23516/visual-machine-learning</link>
	<title><![CDATA[Visual machine learning !!!]]></title>
	<description><![CDATA[<p>In machine learning, computers apply <strong>statistical learning</strong> techniques to automatically identify patterns in data. These techniques can be used to make highly accurate predictions.</p>
<p>More at http://www.r2d3.us/visual-intro-to-machine-learning-part-1/</p><p>Address of the bookmark: <a href="http://www.r2d3.us/visual-intro-to-machine-learning-part-1/" rel="nofollow">http://www.r2d3.us/visual-intro-to-machine-learning-part-1/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

</channel>
</rss>