<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44371?offset=10</link>
	<atom:link href="https://bioinformaticsonline.com/related/44371?offset=10" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36592/lachesis-genome-assembly-with-hi-c-based-contact-probability-maps-lachesis</guid>
	<pubDate>Mon, 14 May 2018 04:26:30 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36592/lachesis-genome-assembly-with-hi-c-based-contact-probability-maps-lachesis</link>
	<title><![CDATA[LACHESIS: Genome Assembly with Hi-C-based Contact Probability Maps (LACHESIS)]]></title>
	<description><![CDATA[<p>LACHESIS is method that exploits contact probability map data (e.g. from Hi-C) for chromosome-scale&nbsp;<em>de novo</em>&nbsp;genome assembly.</p>
<p>Further information about LACHESIS, including source code, documentation and a user's guide are available at:&nbsp;<a href="http://shendurelab.github.io/LACHESIS/">http://shendurelab.github.io/LACHESIS</a>.</p>
<p>Manuscript describing LACHESIS was published as: Burton JN#, Adey A, Patwardhan RP, Qiu R, Kitzman JO, Shendure J#.&nbsp;<em>Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions.</em>&nbsp;Nature Biotechnology 2013 Dec;31(12):1119-25. doi:&nbsp;<a href="http://dx.doi.org/10.1038/nbt.2727">10.1038/nbt.272</a>. PubMed PMID:&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/24185095">24185095</a>.</p>
<p>&nbsp;</p>
<p>http://shendurelab.github.io/LACHESIS/</p><p>Address of the bookmark: <a href="http://shendurelab.github.io/LACHESIS/" rel="nofollow">http://shendurelab.github.io/LACHESIS/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</guid>
	<pubDate>Tue, 07 Aug 2018 10:01:46 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</link>
	<title><![CDATA[VCFtools: perform common tasks with VCF files such as file validation, file merging, intersecting, complements]]></title>
	<description><![CDATA[<p>VCFtools contains a Perl API (<a href="http://vcftools.sourceforge.net/perl_module.html#Vcf.pm">Vcf.pm</a>) and a number of Perl scripts that can be used to perform common tasks with VCF files such as file validation, file merging, intersecting, complements, etc. The Perl tools support all versions of the VCF specification (3.2, 3.3, 4.0, 4.1 and 4.2), nevertheless, the users are encouraged to use the latest versions VCFv4.1 or VCFv4.2. The VCFtools in general have been used mainly with diploid data, but the Perl tools aim to support polyploid data as well. Run any of the Perl scripts with the&nbsp;<strong>--help</strong>&nbsp;switch to obtain more help.</p>
<p>Many of the&nbsp;<strong>Perl scripts require that the VCF files are compressed by&nbsp;<span>bgzip</span>&nbsp;and indexed by&nbsp;<span>tabix</span></strong>&nbsp;(both tools are part of the tabix package, available for&nbsp;<a href="https://sourceforge.net/projects/samtools/files/tabix/">download here</a>). The VCF files can be compressed and indexed using the following commands</p>
<p>bgzip my_file.vcf<br>tabix -p vcf my_file.vcf.gz</p>
<p>&nbsp;</p>
<p>http://vcftools.sourceforge.net/perl_module.html</p><p>Address of the bookmark: <a href="http://vcftools.sourceforge.net/perl_module.html" rel="nofollow">http://vcftools.sourceforge.net/perl_module.html</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36857/%E2%80%9Cone-code-to-find-them-all%E2%80%9D-a-perl-tool-to-conveniently-parse-repeatmasker-output-files</guid>
	<pubDate>Mon, 04 Jun 2018 03:45:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36857/%E2%80%9Cone-code-to-find-them-all%E2%80%9D-a-perl-tool-to-conveniently-parse-repeatmasker-output-files</link>
	<title><![CDATA[“One code to find them all”: a perl tool to conveniently parse RepeatMasker output files]]></title>
	<description><![CDATA[One code to find them all is a set of perl scripts to extract useful information from RepeatMasker about transposable elements, retrieve their sequences and get some quantitative information.

Assemble RepeatMasker hits into complete TE copies, including LTR-retrotransposon
Retrieve corresponding TE sequences, and flanking sequences, from the local fasta files
Compute summary statistics for each TE family (number of TE copies, genome coverage...)
Ambiguous cases such as nested TE can be assembled into copies automatically or manually
Allow for working with a TE user-defined library
Allow for working with only a user-chosen set of TE families


http://doua.prabi.fr/software/one-code-to-find-them-all<p>Address of the bookmark: <a href="http://doua.prabi.fr/software/one-code-to-find-them-all" rel="nofollow">http://doua.prabi.fr/software/one-code-to-find-them-all</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34328/dfast-a-flexible-prokaryotic-genome-annotation-pipeline-for-faster-genome-publication</guid>
	<pubDate>Tue, 14 Nov 2017 10:26:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34328/dfast-a-flexible-prokaryotic-genome-annotation-pipeline-for-faster-genome-publication</link>
	<title><![CDATA[DFAST: a flexible prokaryotic genome annotation pipeline for faster genome publication]]></title>
	<description><![CDATA[<p>We developed a prokaryotic genome annotation pipeline, DFAST, that also supports genome submission to public sequence databases. DFAST was originally started as an on-line annotation server, and to date, over 7,000 jobs have been processed since its first launch in 2016. Here, we present a newly implemented background annotation engine for DFAST, which is also available as a standalone command-line program. The new engine can annotate a typical-sized bacterial genome within 10 minutes, with rich information such as pseudogenes, translation exceptions, and orthologous gene assignment between given reference genomes. In addition, the modular framework of DFAST allows users to customize the annotation workflow easily and will also facilitate extensions for new functions and incorporation of new tools in the future.</p>
<div>Availability and Implementation</div>
<p>The software is implemented in Python 3 and runs in both Python 2.7 and 3.4&ndash; on Macintosh and Linux systems. It is freely available at&nbsp;<a href="https://github.com/nigyta/dfast_core/" target="">https://github.com/nigyta/dfast_core/</a>&nbsp;under the GPLv3 license with external binaries bundled in the software distribution. An on-line version is also available at&nbsp;<a href="https://dfast.nig.ac.jp/" target="">https://dfast.nig.ac.jp/</a>.</p><p>Address of the bookmark: <a href="https://dfast.nig.ac.jp/" rel="nofollow">https://dfast.nig.ac.jp/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</guid>
	<pubDate>Fri, 15 Jun 2018 04:48:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</link>
	<title><![CDATA[mScaffolder: A comparative genome scaffolding tool]]></title>
	<description><![CDATA[<p>A comparative genome scaffolding tool based on MUMmer</p>
<p>mScaffolder scaffolds a genome using an existing high quality genome as the reference. It aligns the two genomes using nucmer utility from MUMmer and then orders and orients the contigs of the candidate genome guided by their alignments to the reference genome. Please send your questions and comments to&nbsp;<a href="mailto:mchakrab@uci.edu">mchakrab@uci.edu</a>.</p>
<p><span>Citation</span><span>&nbsp;</span><a href="https://www.nature.com/articles/s41588-017-0010-y">https://www.nature.com/articles/s41588-017-0010-y</a></p><p>Address of the bookmark: <a href="https://github.com/mahulchak/mscaffolder" rel="nofollow">https://github.com/mahulchak/mscaffolder</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43711/vcf-compare</guid>
	<pubDate>Wed, 19 Jan 2022 10:30:14 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43711/vcf-compare</link>
	<title><![CDATA[VCF Compare !]]></title>
	<description><![CDATA[<h2><span>compare two&nbsp;<strong>BWA</strong>&nbsp;mapping methods with the online hg18-mapped data</span></h2>
<p>We first operate a rapid inspection of the different BAM files using&nbsp;<strong>samtools flagstat</strong>. Illumina provided chr21 read mapping obtained with their&nbsp;<strong>GA IIx</strong>&nbsp;deep sequencing platform &lt;<a href="ftp://webdata:webdata@ussd-ftp.illumina.com/Data/SequencingRuns/NA18507_GAIIx_100_chr21.bam" target="_blank">ftp://webdata:webdata@ussd-ftp.illumina.com/Data/SequencingRuns/NA18507_GAIIx_100_chr21.bam</a>&gt;, aligned to the b36/hg18 reference genome)</p><p>Address of the bookmark: <a href="https://wiki.bits.vib.be/index.php/NGS_Exercise.6#compare_aln_.26_mem_results_with_vcf-compare" rel="nofollow">https://wiki.bits.vib.be/index.php/NGS_Exercise.6#compare_aln_.26_mem_results_with_vcf-compare</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/88/regular-expression-cheat-sheet</guid>
	<pubDate>Tue, 09 Jul 2013 17:38:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/88/regular-expression-cheat-sheet</link>
	<title><![CDATA[Regular Expression Cheat Sheet]]></title>
	<description><![CDATA[<p><span>The Regular Expression are the sole of Perl language, and for bioinformatician it is just a magical stick to resolve gingatic string data. We did not find any good and user friendly regular expression cheat sheet, hence write our own cheat sheet.&nbsp;</span><span>The Regular Expressions Cheat Sheet, a quick reference guide for regular expressions, including symbols, ranges, grouping, assertions and some sample patterns to get you started.</span></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/88" length="14944" type="application/pdf" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36594/fragscaff-genome-assembly-with-contiguity-preserving-transposition</guid>
	<pubDate>Mon, 14 May 2018 04:28:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36594/fragscaff-genome-assembly-with-contiguity-preserving-transposition</link>
	<title><![CDATA[fragScaff: Genome Assembly with Contiguity Preserving Transposition]]></title>
	<description><![CDATA[<p>Contiguity preserving transposition and sequencing (CPT-seq) is an entirely in vitro means of generating libraries comprised of 9216 indexed pools, each of which contains thousands of sparsely sequenced long fragments ranging from 5 kilobases to &gt;1 megabase. This software, fragScaff, leverages coincidences between the content of different pools as a source of contiguity information for scaffolding de novo genome assemblies. FragScaff is complementary to Lachesis, providing midrange contiguity to support robust, accurate chromosome-scale de novo genome assemblies without the need for laborious in vivo cloning steps.</p>
<p>Further information about fragScaff, including source code, is available at:<a href="https://sourceforge.net/projects/fragscaff/files/">https://sourceforge.net/projects/fragscaff/files</a>.</p>
<p>Manuscript describing fragScaff was published as: Adey A, Kitzman JO, Burton JN, Daza R, Kumar A, Christiansen L, Ronaghi M, Amini S, L Gunderson K, Steemers FJ, Shendure J#.&nbsp;<em>In vitro, long-range sequence information for de novo genome assembly via transposase contiguity.</em>&nbsp;Genome Research 2014 Dec;24(12):2041-9. doi:&nbsp;<a href="http://dx.doi.org/10.1101/gr.178319.114">10.1101/gr.178319.114</a>. PubMed PMID:&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/25327137">25327137</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/fragscaff/files/" rel="nofollow">https://sourceforge.net/projects/fragscaff/files/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</guid>
	<pubDate>Fri, 13 Jul 2018 19:50:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</link>
	<title><![CDATA[Genome U-Plot: a whole genome visualization]]></title>
	<description><![CDATA[<p><span>Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.&nbsp;</span></p>
<p><span>https://github.com/gaitat/GenomeUPlot</span></p><p>Address of the bookmark: <a href="https://github.com/gaitat/GenomeUPlot" rel="nofollow">https://github.com/gaitat/GenomeUPlot</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>