Perl one-liners are small and awesome Perl programs that fit in a single line of code and they do one thing really well. These things include changing line spacing, numbering lines, doing calculations, converting and substituting text, deleting and printing certain lines, parsing logs, editing files in-place, doing statistics, carrying out system administration tasks, updating a bunch of files at once, and many more. Perl one-liners will make you the shell warrior. Anything that took you minutes to solve, will now take you seconds!

perl -pe '$\="\n"'   
#double space a file

perl -pe '$_ .= "\n" unless /^$/'
#double space a file except blank lines

perl -pe '$_.="\n"x7'
#7 space in a line.

perl -ne 'print unless /^$/'
#remove all blank lines

perl -lne 'print if length($_) < 20'
#print all lines with length less than 20.

perl -00 -pe ''
#If there are multiple spaces, delete all leaving one(make the file a single spaced file).

perl -00 -pe '$_.="\n"x4'
#Expand single blank lines into 4 consecutive blank lines

perl -pe '$_ = "$. $_"'
#Number all lines in a file

perl -pe '$_ = ++$a." $_" if /./'
#Number only non-empty lines in a file

perl -ne 'print ++$a." $_" if /./'
#Number and print only non-empty lines in a file

perl -pe '$_ = ++$a." $_" if /regex/'
#Number only lines that match a pattern

perl -ne 'print ++$a." $_" if /regex/'
#Number and print only lines that match a pattern

perl -ne 'printf "%-5d %s", $., $_ if /regex/'
#Left align lines with 5 white spaces if matches a pattern (perl -ne 'printf "%-5d %s", $., $_' : for all the lines)

perl -le 'print scalar(grep{/./}<>)'
#prints the total number of non-empty lines in a file

perl -lne '$a++ if /regex/; END {print $a+0}'
#print the total number of lines that matches the pattern

perl -alne 'print scalar @F'
#print the total number fields(words) in each line.

perl -alne '$t += @F; END { print $t}'
#Find total number of words in the file

perl -alne 'map { /regex/ && $t++ } @F; END { print $t }'
#find total number of fields that match the pattern

perl -lne '/regex/ && $t++; END { print $t }'
#Find total number of lines that match a pattern

perl -le '$n = 20; $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $m'
#will calculate the GCD of two numbers.

perl -le '$a = $n = 20; $b = $m = 35; ($m,$n) = ($n,$m%$n) while $n; print $a*$b/$m'
#will calculate lcd of 20 and 35.

perl -le '$n=10; $min=5; $max=15; $, = " "; print map { int(rand($max-$min))+$min } 1..$n'
#Generates 10 random numbers between 5 and 15.

perl -le 'print map { ("a".."z",”0”..”9”)[rand 36] } 1..8'
#Generates a 8 character password from a to z and number 0 – 9.

perl -le 'print map { ("a",”t”,”g”,”c”)[rand 4] } 1..20'
#Generates a 20 nucleotide long random residue.

perl -le 'print "a"x50'
#generate a string of ‘x’ 50 character long

perl -le 'print join ", ", map { ord } split //, "hello world"'
#Will print the ascii value of the string hello world.

perl -le '@ascii = (99, 111, 100, 105, 110, 103); print pack("C*", @ascii)'
#converts ascii values into character strings.

perl -le '@odd = grep {$_ % 2 == 1} 1..100; print "@odd"'
#Generates an array of odd numbers.

perl -le '@even = grep {$_ % 2 == 0} 1..100; print "@even"'
#Generate an array of even numbers

perl -lpe 'y/A-Za-z/N-ZA-Mn-za-m/' file
#Convert the entire file into 13 characters offset(ROT13)

perl -nle 'print uc'
#Convert all text to uppercase:

perl -nle 'print lc'
#Convert text to lowercase:

perl -nle 'print ucfirst lc'
#Convert only first letter of first word to uppercas

perl -ple 'y/A-Za-z/a-zA-Z/'
#Convert upper case to lower case and vice versa

perl -ple 's/(\w+)/\u$1/g'
#Camel Casing

perl -pe 's|\n|\r\n|'
#Convert unix new lines into DOS new lines:

perl -pe 's|\r\n|\n|'
#Convert DOS newlines into unix new line

perl -pe 's|\n|\r|'
#Convert unix newlines into MAC newlines:

perl -pe '/regexp/ && s/foo/bar/'
#Substitute a foo with a bar in a line with a regexp.

Reference/Sources:

http://genomics-array.blogspot.in/2010/11/some-unixperl-oneliners-for.html

http://genomespot.blogspot.com/2013/08/a-selection-of-useful-bash-one-liners.html

http://biowize.wordpress.com/2012/06/15/command-line-magic-for-your-gene-annotations/

http://genomics-array.blogspot.com/2010/11/some-unixperl-oneliners-for.html

http://bioexpressblog.wordpress.com/2013/04/05/split-multi-fasta-sequence-file/

Address of the bookmark: http://www.repeatmasker.org/RepeatModeler.html

Many of the Perl scripts require that the VCF files are compressed by bgzip and indexed by tabix (both tools are part of the tabix package, available for download here). The VCF files can be compressed and indexed using the following commands

bgzip my_file.vcf
tabix -p vcf my_file.vcf.gz

http://vcftools.sourceforge.net/perl_module.html

Address of the bookmark: http://vcftools.sourceforge.net/perl_module.html

The software is implemented in Python 3 and runs in both Python 2.7 and 3.4– on Macintosh and Linux systems. It is freely available at https://github.com/nigyta/dfast_core/ under the GPLv3 license with external binaries bundled in the software distribution. An on-line version is also available at https://dfast.nig.ac.jp/.

Address of the bookmark: https://dfast.nig.ac.jp/

mScaffolder scaffolds a genome using an existing high quality genome as the reference. It aligns the two genomes using nucmer utility from MUMmer and then orders and orients the contigs of the candidate genome guided by their alignments to the reference genome. Please send your questions and comments to mchakrab@uci.edu.

Citation https://www.nature.com/articles/s41588-017-0010-y

Address of the bookmark: https://github.com/mahulchak/mscaffolder

We first operate a rapid inspection of the different BAM files using samtools flagstat. Illumina provided chr21 read mapping obtained with their GA IIx deep sequencing platform <ftp://webdata:webdata@ussd-ftp.illumina.com/Data/SequencingRuns/NA18507_GAIIx_100_chr21.bam>, aligned to the b36/hg18 reference genome)

Address of the bookmark: https://wiki.bits.vib.be/index.php/NGS_Exercise.6#compare_aln_.26_mem_results_with_vcf-compare

Address of the bookmark: https://urgi.versailles.inra.fr/Tools/REPET/TEannot-tuto

What is Genome Assembly?

Genome assembly involves piecing together short DNA sequence reads generated by sequencing platforms (e.g., Illumina, PacBio, Oxford Nanopore) into longer, contiguous sequences called contigs. This can be performed as:

• De Novo Assembly: Without a reference genome.
• Reference-Guided Assembly: Using a reference genome to guide the assembly process.

Step 1: Preparing Your Data

Before starting the assembly, ensure that your raw sequencing data is high quality.

1. Input Data

   • Short Reads: Illumina sequencing generates short, accurate reads ideal for scaffolding.
   • Long Reads: PacBio and Nanopore sequencing provide long reads for resolving repetitive regions.

2. Quality Control (QC)
   Use tools like FastQC or MultiQC to assess the quality of your reads:

   fastqc reads.fastq multiqc .

   Look for issues like low-quality bases, adapter contamination, or overrepresented sequences.

3. Read Trimming and Filtering
   Trim low-quality bases and adapters using Trimmomatic or Cutadapt:

   trimmomatic PE reads_R1.fastq reads_R2.fastq trimmed_R1.fastq trimmed_R2.fastq \ ILLUMINACLIP:adapters.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:36

Step 2: Choosing an Assembly Strategy

Select an assembly strategy based on your data type:

• Short-Read Assemblers:

  • SPAdes: Popular for microbial genomes.
  • Velvet: Fast for smaller genomes.

• Long-Read Assemblers:

  • Canu: Ideal for long-read datasets.
  • Flye: Versatile for small and large genomes.

• Hybrid Assemblers:

  • MaSuRCA: Combines short and long reads.
  • Unicycler: Optimized for bacterial genomes.

Step 3: Running the Assembly

3.1. SPAdes (Short-Read Assembly)

SPAdes is an excellent choice for small genomes, such as bacteria.

The output includes assembled contigs (contigs.fasta) and scaffolds (scaffolds.fasta).

3.2. Canu (Long-Read Assembly)

Canu is designed for high-error long reads from PacBio or Nanopore.

The output will be in canu_output/genome.contigs.fasta.

3.3. Hybrid Assembly with Unicycler

Unicycler combines short and long reads for improved assemblies.

Step 4: Assessing Assembly Quality

After assembly, evaluate its quality using the following tools:

1. QUAST
   QUAST generates assembly statistics, such as N50, genome size, and GC content:

   quast contigs.fasta -o quast_output

2. BUSCO
   BUSCO checks genome completeness by identifying conserved genes:

   busco -i contigs.fasta -o busco_output -l fungi_odb10 -m genome

3. Assembly Graph Visualization
   Visualize assembly graphs with Bandage:

   Bandage load assembly_graph.gfa

Step 5: Post-Assembly Steps

1. Polishing
   Improve assembly accuracy using tools like Pilon (for short reads) or Racon (for long reads).

   racon long_reads.fasta mapped_reads.sam contigs.fasta > polished_contigs.fasta

2. Scaffolding
   Link contigs into scaffolds using tools like SSPACE or Opera-LG if required.

3. Annotation
   Annotate the assembled genome using Prokka for prokaryotes or Maker for eukaryotes.

   prokka --outdir annotation_output --prefix genome contigs.fasta

Step 6: Sharing and Archiving

1. Submit to Public Repositories
   Share your assembly in databases like NCBI GenBank, ENA, or DDBJ.

2. Metadata Preparation
   Include detailed metadata for your submission, such as organism name, sequencing platform, and coverage.

Best Practices

• Always perform quality checks at each stage to ensure data integrity.
• Use multiple tools to cross-validate results when working with complex genomes.
• Document parameters and software versions for reproducibility.

Conclusion

Genome assembly is a powerful process that transforms raw sequencing data into a coherent representation of an organism’s genome. By following this step-by-step guide, you can successfully assemble genomes and uncover valuable biological insights. Whether you’re assembling a microbial genome or tackling the complexities of a eukaryotic genome, these tools and strategies will set you on the path to success.

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr