BOL: Related items

Perl Maven tutorial by Gabor Szabo

Jitendra Narayan — Fri, 09 Aug 2013 05:43:10 -0500

I personally reccoment this tutorial for Perl users.

More detail http://perlmaven.com/

Cava Deployment Tools

Jitendra Narayan — Wed, 14 Aug 2013 15:00:48 -0500

Cava Packager allows packaging of applications written in Perl. Packaged applications can be distributed without the need for an installation of Perl on the target machine. Cava Packager is currently distributed under a free to use license.

Supported Perl Versions

Threaded Perl with a shared libperl 5.8, 5.10, 5.12, 5.14, 5.16

Supported Operating Systems

    MS Windows XP and later 32 and 64 bit.

    Linux 32 and 64 bit - minimum glibc 2.5, GTK+ 2.10, libstdc++6.

    Linux 32 bit RHEL 3 and 4.

    Mac OSX 10.4 and 10.5 - ppc and i386.

    Mac OSX 10.6, 10.7, 10.8 - i386 and x86_64 ( 64 bit for Perl 5.16 only ).

Address of the bookmark: http://www.cavapackager.com/

Detect the sequence pattern and its location in fasta file with match and mismatches information.

Jit — Thu, 26 Sep 2013 15:02:53 -0500

This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line ..

To run:

perl centro.pl

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Scientist - Computational Genomics (Two Positions)

Sat, 12 Mar 2016 18:07:56 -0600

ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.

ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.

Responsibilities:Design efficient SQL queries for pulling large sequencing projects.
Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.
Develop and oversee a rapid and incremental software development and release schedule.
Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.
Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.
Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.
Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.
Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.
Assist in training of breeders in the CGIAR centers to use software developed.
Personal Profile:

The applicant should have:

Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL
High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.
She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.
Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.
Ability to mentor colleagues in quality software development practices is desired.
Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.

More at http://www.icrisat.org/careers/

Perl way to check if an array contains values

Shruti Paniwala — Thu, 09 Mar 2017 17:17:01 -0600

Perl is always is known for their flexibility (There is more than one way to do it).

Followings are the quick way to check if a value exist in an array.

do_something if 'flour' ~~ @ingredients # ~~ operand. BEWARE: it is broken.

do_something if grep {$_ eq 'flour'} @ingredients # grep (slower than 'any')

do_something if any {$_ eq 'flour'} @ingredients # List::MoreUtils / Util::Any

do_something if any(@ingredients) eq 'flour' # use syntax 'junction';

do_something if @ingredients->contains('flour') # added with autobox

Circleator

Jit — Sun, 25 Jun 2017 18:04:32 -0500

The Charm City Circleator--or Circleator for short--is a Perl-based visualization tool developed at the Institute for Genome Sciences in the University of Maryland's School of Medicine. Circleator produces circular plots of genome-associated data, like this one:

Common uses of the tool include:

Displaying the sequence and/or genes in a GenBank flat file.
Highlighting differences and/or similarities in gene content between related organisms.
Comparing SNPs and indels between closely-related strains or serovars.
Comparing gene expression values across multiple samples or timepoints.
Visualizing coverage plots of RNA-Seq read alignments.

Key Features

Circleator...

Builds on BioPerl and the input file formats that it supports, including:
- GenBank flat files, GFF, FASTA
Accepts a number of other commonly-used datatypes and file formats:
- BSR and TRF output, SAM/BAM files, VCF-encoded SNPs, tab-delimited files
Outputs publication-ready figures in the SVG (Scalable Vector Graphics) format.
Requires only a single configuration file whose layout mirrors that of the figure itself.
- Predefined configuration files and "track" types are supplied for common datasets.
- Advanced features allow limited analyses to be performed as a figure is drawn.
Includes an extensive set of regression tests.
Offers a prototype web-based GUI (under the "Ringmaster" project.)

https://github.com/jonathancrabtree/Circleator

Address of the bookmark: https://github.com/jonathancrabtree/Circleator

Frontend: Perl Web framework documentation - Andrej Sali Lab

Jit — Mon, 08 Jan 2018 22:32:03 -0600

The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main saliwebfrontend class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.

Address of the bookmark: https://saliweb.readthedocs.io/en/latest/frontend.html

The Raku Programming Language

Jit — Tue, 28 Jan 2020 05:37:17 -0600

Raku is a member of the Perl family of programming languages. Formerly known as Perl 6, it was renamed in October 2019. Raku introduces elements of many modern and historical languages. Compatibility with Perl was not a goal, though a compatibility mode is part of the specification.

More at https://www.raku.org/

Address of the bookmark: https://www.raku.org/