<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44375?offset=40</link>
	<atom:link href="https://bioinformaticsonline.com/related/44375?offset=40" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41464/phytozome-v121-plant-science-community-hub-for-accessing-palnts-genomic-data</guid>
	<pubDate>Tue, 17 Mar 2020 07:30:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41464/phytozome-v121-plant-science-community-hub-for-accessing-palnts-genomic-data</link>
	<title><![CDATA[Phytozome  v12.1: plant science community hub for accessing palnts genomic data]]></title>
	<description><![CDATA[<p>Phytozome, the Plant Comparative Genomics portal of the Department of Energy's Joint Genome Institute, provides JGI users and the broader plant science community a hub for accessing, visualizing and analyzing JGI-sequenced plant genomes, as well as selected genomes and datasets that have been sequenced elsewhere. As of release v12.1.6, Phytozome hosts 93 assembled and annotated genomes, from 82 Viridiplantae species. More than half of these genomes have been sequenced, assembled and/or annotated with JGI Plant Science program resources. By integrating this large collection of plant genomes into a single resource and performing comprehensive and uniform annotation and analyses, Phytozome facilitates accurate and insightful comparative genomics studies.</p><p>Address of the bookmark: <a href="https://phytozome.jgi.doe.gov/pz/portal.html" rel="nofollow">https://phytozome.jgi.doe.gov/pz/portal.html</a></p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43641/refseq-viraal-genome-sequences</guid>
	<pubDate>Sat, 11 Dec 2021 08:35:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43641/refseq-viraal-genome-sequences</link>
	<title><![CDATA[Refseq viraal genome sequences !]]></title>
	<description><![CDATA[<p>List of all viruses on NCBI&nbsp;</p>
<p>https://ftp.ncbi.nlm.nih.gov/refseq/release/viral/</p><p>Address of the bookmark: <a href="https://ftp.ncbi.nlm.nih.gov/refseq/release/viral/" rel="nofollow">https://ftp.ncbi.nlm.nih.gov/refseq/release/viral/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35635/ete-3-reconstruction-analysis-and-visualization-of-phylogenomic-data</guid>
	<pubDate>Mon, 19 Feb 2018 06:46:15 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35635/ete-3-reconstruction-analysis-and-visualization-of-phylogenomic-data</link>
	<title><![CDATA[ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data]]></title>
	<description><![CDATA[<p><span>ETE v3, featuring numerous improvements in the underlying library of methods, and providing a novel set of standalone tools to perform common tasks in comparative genomics and phylogenetics. </span></p>
<p><span>The new features include </span></p>
<p><span>(i) building gene-based and supermatrix-based phylogenies using a single command, </span></p>
<p><span>(ii) testing and visualizing evolutionary models, </span></p>
<p><span>(iii) calculating distances between trees of different size or including duplications, and </span></p>
<p><span>(iv) providing seamless integration with the NCBI taxonomy database. </span></p>
<p><span>ETE is freely available at&nbsp;</span><a href="http://etetoolkit.org/" target="">http://etetoolkit.org</a></p><p>Address of the bookmark: <a href="http://etetoolkit.org" rel="nofollow">http://etetoolkit.org</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40613/genome-in-a-bottle-giab-consortium</guid>
	<pubDate>Sat, 25 Jan 2020 13:50:52 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40613/genome-in-a-bottle-giab-consortium</link>
	<title><![CDATA[Genome in a Bottle (GIAB) Consortium]]></title>
	<description><![CDATA[<p><span>The</span><a href="http://www.genomeinabottle.org/"> Genome in a Bottle (GIAB) Consortium</a><span> is a public-private-academic consortium hosted by </span><a href="http://www.nist.gov/" target="_blank">NIST</a><span> to develop the technical infrastructure (reference standards, reference methods, and reference data) to enable translation of whole human genome sequencing to clinical practice. </span></p>
<p><span><a href="https://www.nist.gov/news-events/news/2016/09/nist-releases-new-family-standardized-genomes">https://www.nist.gov/news-events/news/2016/09/nist-releases-new-family-standardized-genomes</a></span></p><p>Address of the bookmark: <a href="https://jimb.stanford.edu/giab/" rel="nofollow">https://jimb.stanford.edu/giab/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</guid>
	<pubDate>Fri, 15 Jun 2018 04:48:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</link>
	<title><![CDATA[mScaffolder: A comparative genome scaffolding tool]]></title>
	<description><![CDATA[<p>A comparative genome scaffolding tool based on MUMmer</p>
<p>mScaffolder scaffolds a genome using an existing high quality genome as the reference. It aligns the two genomes using nucmer utility from MUMmer and then orders and orients the contigs of the candidate genome guided by their alignments to the reference genome. Please send your questions and comments to&nbsp;<a href="mailto:mchakrab@uci.edu">mchakrab@uci.edu</a>.</p>
<p><span>Citation</span><span>&nbsp;</span><a href="https://www.nature.com/articles/s41588-017-0010-y">https://www.nature.com/articles/s41588-017-0010-y</a></p><p>Address of the bookmark: <a href="https://github.com/mahulchak/mscaffolder" rel="nofollow">https://github.com/mahulchak/mscaffolder</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41831/merqury-reference-free-quality-and-phasing-assessment-for-genome-assemblies</guid>
	<pubDate>Sat, 06 Jun 2020 05:38:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41831/merqury-reference-free-quality-and-phasing-assessment-for-genome-assemblies</link>
	<title><![CDATA[Merqury: reference-free quality and phasing assessment for genome assemblies]]></title>
	<description><![CDATA[<p><span>Often, genome assembly projects have illumina whole genome sequencing reads available for the assembled individual. The k-mer spectrum of this read set can be used for independently evaluating assembly quality without the need of a high quality reference. Merqury provides a set of tools for this purpose.</span></p>
<p><span><a href="https://github.com/marbl/meryl">https://github.com/marbl/meryl</a></span></p><p>Address of the bookmark: <a href="https://github.com/marbl/merqury" rel="nofollow">https://github.com/marbl/merqury</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>