<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44403?offset=70</link>
	<atom:link href="https://bioinformaticsonline.com/related/44403?offset=70" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42552/bioinformatics-workbook</guid>
	<pubDate>Tue, 05 Jan 2021 22:42:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42552/bioinformatics-workbook</link>
	<title><![CDATA[bioinformatics workbook]]></title>
	<description><![CDATA[<p><span>This books assumes that the reader has some knowledge of biology and basic understanding of the Unix command line. However, for the beginner, the appendix contains introductory material and tips/tricks for common bioinformatic problems, that is referred to for more information throughout the book.</span></p>
<p>https://bioinformaticsworkbook.org/</p><p>Address of the bookmark: <a href="https://bioinformaticsworkbook.org/" rel="nofollow">https://bioinformaticsworkbook.org/</a></p>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44179/python-mini-projects</guid>
	<pubDate>Mon, 16 Jan 2023 02:14:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44179/python-mini-projects</link>
	<title><![CDATA[Python Mini Projects !]]></title>
	<description><![CDATA[<p><span>There is a directory for each chapter of the book. Each directory contains a&nbsp;</span><code>test.py</code><span>&nbsp;program you can use with&nbsp;</span><code>pytest</code><span>&nbsp;to check that you have written the program correctly. I have included a short README to describe each exercise. If you have problems writing code (or if you would like to support this project!), the book contains details about the skills you need.</span></p>
<p>https://github.com/kyclark/tiny_python_projects</p><p>Address of the bookmark: <a href="https://github.com/kyclark/tiny_python_projects" rel="nofollow">https://github.com/kyclark/tiny_python_projects</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/898/ruby-language</guid>
	<pubDate>Mon, 15 Jul 2013 01:34:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/898/ruby-language</link>
	<title><![CDATA[Ruby Language]]></title>
	<description><![CDATA[<p>Ruby was created by Yukihiro Matsumoto, who wished to create a new language that balanced functional programming with imperative programming</p><p>Ruby is a dynamic, reflective, general purpose object-oriented programming language that combines syntax inspired by Perl with Smalltalk-like features. Ruby originated in Japan during the mid-1990s and was initially developed and designed by Yukihiro "Matz" Matsumoto. It was influenced primarily by Perl, Smalltalk, Eiffel, and Lisp.</p><p>Ruby supports multiple programming paradigms, including functional, object oriented, imperative and reflective. It also has a dynamic typesystem and automatic memory management; it is therefore similar in varying respects to Python, Perl, Lisp, Dylan, Pike, and CLU.</p><p>The standard 1.8.7 implementation is written in C, as a single-pass interpreted language. There is currently no specification of the Ruby language, so the original implementation is considered to be the de facto reference. As of 2010, there are a number of complete or upcoming alternative implementations of the Ruby language, including YARV, JRuby, Rubinius, IronRuby, MacRuby and HotRuby, each of which takes a different approach, with IronRuby, JRuby and MacRuby providing just-in-time compilation and MacRuby also providing ahead-of-time compilation. The official 1.9 branch uses YARV, as will 2.0 (development), and will eventually supersede the slower Ruby MRI.</p><p>Ruby Quick Reference<br />http://www.zenspider.com/Languages/Ruby/QuickRef.html</p><p>Ruby Annotation<br />http://www.w3.org/TR/ruby/</p><p>Ruby in Linux Journals<br />http://www.linuxjournal.com/article/5915</p><p>Ruby Documentation: Programming Ruby<br />http://ruby-doc.org/docs/ProgrammingRuby/</p><p>The Top 10 Reasons The Ruby Programming Language Sucks</p><p>http://www.slideshare.net/vishnu/the-top-10-reasons-the-ruby-programming-language-sucks</p><p>Ruby : The Programmers best friends<br />http://www.ruby-lang.org/en/</p><p>For Ruby Beginners<br />http://www.squidoo.com/ruby-programming-beginner</p><p>Ruby Programming<br />http://en.wikibooks.org/wiki/Ruby_Programming</p><p>Ruby CookBook<br />http://en.wikibooks.org/wiki/Cookbook:Table_of_Contents</p><p>Ruby Programming Challenge for Newbies -<br />http://rubylearning.com/blog/ruby-programming-challenge-faq/</p><p>Common "issues" faced by Ruby Newbies by Chris Strom -<br />http://japhr.blogspot.com/2009/10/newbie-feedback.html</p><p>Books<br />http://www.sapphiresteel.com/The-Book-Of-Ruby</p><p>Free Online Ruby Programming along with many Ruby newbies here -<br />http://rubylearning.org/class/</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/poll/view/15000/which-mathstatistics-programming-languageapplication-do-you-most-frequently-use-in-bioinformatics</guid>
	<pubDate>Thu, 04 Sep 2014 17:46:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/poll/view/15000/which-mathstatistics-programming-languageapplication-do-you-most-frequently-use-in-bioinformatics</link>
	<title><![CDATA[Which math/statistics programming language/application do you most frequently use in bioinformatics?]]></title>
	<description><![CDATA[<p>I'm doing a bit more statistical analysis on some bioinformatics things lately, and I'm curious if there are any programming languages that are particularly good for this NGS computation. What suggestions do you guys have? Are there any languages that have exceptionally good libraries?</p>]]></description>
	<dc:creator>John Parker</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36413/insert-data-through-ajax-into-mysql-database</guid>
	<pubDate>Wed, 25 Apr 2018 12:43:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36413/insert-data-through-ajax-into-mysql-database</link>
	<title><![CDATA[Insert data through ajax into MySql database.]]></title>
	<description><![CDATA[<p>Insert data through ajax into MySql database.1. Create form.php and copy below code into file.</p><blockquote><p>&lt;script type="text/javascript"&gt;<br /> <br /> $(document).ready(function(){<br /> $('#submit').click(function(){<br /> var name= $('#name').val();<br /> var email= $('#email').val();<br /> var sdatatring='name1='+ name +'&amp;email1='+ email;<br /> $.ajax({<br /> type:"POST",<br /> url:"insert.php",<br /> data:sdatatring,<br /> cache: false,<br /> success:function(result){<br /> alert(result);</p><p>}});</p><p>});</p><p>});<br />&lt;/script&gt;<br /> &lt;form method="post" action="" name="frm"&gt;<br /> Name:&lt;input type="text" name="name" id="name" value=""&gt;&lt;br&gt;<br /> Email:&lt;input type="text" name="email" id="email" value=""&gt;&lt;br&gt;<br /> &lt;input type="button" name="submt" id="submit" value="submit" /&gt;<br /> <br /> &lt;/form&gt;</p><p>2. Create insert.php and copy below code into file.<br /> &lt;?php<br />print_r($_POST);<br />$con=mysql_connect("localhost","root","");<br />mysql_select_db('dbname');<br />mysql_query('insert into tablename('colname')values(value)');<br /> ?&gt;<br />Note:You need to include jQuery library in form.php.</p></blockquote><p>More at</p><p>https://phpajaxhtml.blogspot.in/2018/03/insert-data-through-ajax-into-mysql.html</p>]]></description>
	<dc:creator>Ram Yash Pal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</guid>
	<pubDate>Tue, 28 Jan 2020 05:37:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40724/the-raku-programming-language</link>
	<title><![CDATA[The Raku Programming Language]]></title>
	<description><![CDATA[<p><span>Raku is a member of the Perl family of programming languages. Formerly known as Perl 6, it was renamed in October 2019. Raku introduces elements of many modern and historical languages. Compatibility with Perl was not a goal, though a compatibility mode is part of the specification.</span><span>&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://www.raku.org/">https://www.raku.org/</a></span></p><p>Address of the bookmark: <a href="https://www.raku.org/" rel="nofollow">https://www.raku.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35148/mojolicious-a-next-generation-web-framework-for-the-perl-programming-language</guid>
	<pubDate>Fri, 12 Jan 2018 16:48:10 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35148/mojolicious-a-next-generation-web-framework-for-the-perl-programming-language</link>
	<title><![CDATA[mojolicious: a next generation web framework for the Perl programming language.]]></title>
	<description><![CDATA[<p><span>Back in the early days of the web, many people learned Perl because of a wonderful Perl library called&nbsp;</span><a href="https://metacpan.org/module/CGI" target="_blank">CGI</a><span>. It was simple enough to get started without knowing much about the language and powerful enough to keep you going, learning by doing was much fun. While most of the techniques used are outdated now, the idea behind it is not. Mojolicious is a new endeavor to implement this idea using bleeding edge technologies.</span></p>
<h2>Features</h2>
<ul>
<li>An amazing&nbsp;<strong>real-time web framework</strong>, allowing you to easily grow single file prototypes into well-structured MVC web applications.
<ul>
<li>Powerful out of the box with RESTful routes, plugins, commands, Perl-ish templates, content negotiation, session management, form validation, testing framework, static file server, CGI/<a href="http://plackperl.org/" target="_blank">PSGI</a>&nbsp;detection, first class Unicode support and much more for you to discover.</li>
</ul>
</li>
<li>A powerful&nbsp;<strong>web development toolkit</strong>, that you can use for all kinds of applications, independently of the web framework.
<ul>
<li>Full stack HTTP and WebSocket client/server implementation with IPv6, TLS, SNI, IDNA, HTTP/SOCKS5 proxy, UNIX domain socket, Comet (long polling), Promises/A+, keep-alive, connection pooling, timeout, cookie, multipart and gzip compression support.</li>
<li>Built-in non-blocking I/O web server, supporting multiple event loops as well as optional pre-forking and hot deployment, perfect for building highly scalable web services.</li>
<li>JSON and HTML/XML parser with CSS selector support.</li>
</ul>
</li>
<li>Very clean, portable and object-oriented pure-Perl API with no hidden magic and no requirements besides Perl 5.24.0 (versions as old as 5.10.1 can be used too, but may require additional CPAN modules to be installed)</li>
<li>Fresh code based upon years of experience developing&nbsp;<a href="http://catalystframework.org/" target="_blank">Catalyst</a>, free and open source.</li>
<li>Hundreds of 3rd party&nbsp;<a href="https://metacpan.org/requires/distribution/Mojolicious">extensions</a>&nbsp;and high quality spin-off projects like the&nbsp;<a href="https://metacpan.org/pod/Minion">Minion</a>&nbsp;job queue.</li>
</ul>
<p>http://mojolicious.org/</p><p>Address of the bookmark: <a href="http://mojolicious.org/" rel="nofollow">http://mojolicious.org/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/2253/best-practices-in-bioinformatics-training-for-life-scientists</guid>
	<pubDate>Tue, 13 Aug 2013 15:47:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/2253/best-practices-in-bioinformatics-training-for-life-scientists</link>
	<title><![CDATA[Best practices in bioinformatics training for life scientists]]></title>
	<description><![CDATA[<p>Among life scientists, from clinicians to environmental researchers, a common theme is the need not just to use, and gain familiarity with, bioinformatics tools and resources but also to understand their underlying fundamental theoretical and practical concepts.</p>
<p>Find the detail paper at http://bib.oxfordjournals.org/content/early/2013/06/25/bib.bbt043.full</p><p>Address of the bookmark: <a href="http://bib.oxfordjournals.org/content/early/2013/06/25/bib.bbt043.full" rel="nofollow">http://bib.oxfordjournals.org/content/early/2013/06/25/bib.bbt043.full</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>

</channel>
</rss>