BOL: Related items

CheckM:Assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes

Rahul Nayak — Wed, 23 May 2018 04:39:26 -0500

CheckM provides a set of tools for assessing the quality of genomes recovered from isolates, single cells, or metagenomes. It provides robust estimates of genome completeness and contamination by using collocated sets of genes that are ubiquitous and single-copy within a phylogenetic lineage. Assessment of genome quality can also be examined using plots depicting key genomic characteristics (e.g., GC, coding density) which highlight sequences outside the expected distributions of a typical genome. CheckM also provides tools for identifying genome bins that are likely candidates for merging based on marker set compatibility, similarity in genomic characteristics, and proximity within a reference genome tree.

Address of the bookmark: http://ecogenomics.github.io/CheckM/

Blobsplorer

Jit — Tue, 14 Jun 2016 10:28:58 -0500

Blobsplorer is a tool for interactive visualization of assembled DNA sequence data ("contigs") derived from (often unintentionally) mixed-species pools. It allows the simultaneous display of GC content, coverage, and taxonomic annotation for collections of contigs with a view to separating out those belonging to different taxa.

Blobsplorer is unlikely to be of use on its own as it requires contig data to be supplied in a format that involves considerable preprocessing (see below for a description). The easiest way to use Blobsplorer is as part of a workflow using scripts from here.

Address of the bookmark: http://nematodes.org/martin/blobsplorer/blobsplorer.html

Graph Genome Suite

Jit — Fri, 28 Oct 2016 07:59:54 -0500

Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the Graph Genome Suite — the most advanced population genomics tools in the world.

Address of the bookmark: https://www.sbgenomics.com/graph/

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

JumboDB: tool for de Bruijn graph construction

BioStar — Tue, 17 Aug 2021 13:33:46 -0500

jumboDB tool for fast de Bruijn graph construction from long sequences (reads or genomes) with very low error rate. JumboDB is not a genome assembler by itself but rather a subroutine that translates a set of reads into compressed de Bruijn graph.

More at https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/AntonBankevich/jumboDB

RAMI: a tool for identification and characterization of phylogenetic clusters in microbial communities

Jit — Mon, 07 Aug 2017 18:49:27 -0500

RAMI, which clusters related nodes in a phylogenetic tree based on the patristic distance. RAMI also produces indices of cluster properties and other indices used in population and community studies on-the-fly.

Availability: RAMI is licensed under GNU GPL and can be run or downloaded from http://www.acgt.se/online.html.

Address of the bookmark: https://academic.oup.com/bioinformatics/article-lookup/doi/10.1093/bioinformatics/btp051

postdoctoral fellow for a large-scale microbial comparative genomics !

Thu, 29 Apr 2021 08:44:53 -0500

Asaf Levy hiring a postdoctoral fellow for a large-scale microbial comparative genomics project at the Hebrew University of Jerusalem (Israel).
The project is a continuation of Levy Asaf et al. Nature Genetics 2018 paper.
Requirements:
1.Experience with programming in at least one programming language, preferably Python.
2.A PhD in bioinformatics/computational biology
3.At least one first authorship publication in a good journal, preferably more.
4.Good communication skills in English
5.Ability to enter and study in Israel (not applicable for Pakistani people, for example).
6.Ability to work in a team.
Please send CV to alevy@mail.huji.ac.il

MCMCTREE: a phylogenetic program for Bayesian estimation of species divergence times

Poonam Mahapatra — Sat, 02 Jun 2018 07:40:06 -0500

MCMCTREE is a phylogenetic program for Bayesian estimation of species divergence times using soft fossil constraints under various molecular clock models. This is part of the PAML package. In this tutorial I will analyze an easy example modified from dataset of Inoue et al. (2010). Here we conduct a commonly used time estimation method, "Approximate Likelihood Method", for the datasets including more than 10 species.

Address of the bookmark: http://www.fish-evol.com/mcmctreeExampleVert6/text1Eng.html

R Graphs !!

Jit — Fri, 04 Nov 2016 10:48:00 -0500

The blog is a collection of script examples with example data and output plots. R produce excellent quality graphs for data analysis, science and business presentation, publications and other purposes. Self-help codes and examples are provided. Enjoy nice graphs !!

Address of the bookmark: http://rgraphgallery.blogspot.be/