BOL: Related items

ARCS: scaffolding genome drafts with linked reads

Rahul Nayak — Tue, 06 Mar 2018 16:35:26 -0600

ARCS, an application that utilizes the barcoding information contained in linked reads to further organize draft genomes into highly contiguous assemblies. We show how the contiguity of an ABySS H.sapiensgenome assembly can be increased over six-fold, using moderate coverage (25-fold) Chromium data. We expect ARCS to have broad utility in harnessing the barcoding information contained in linked read data for connecting high-quality sequences in genome assembly drafts.

Address of the bookmark: https://github.com/bcgsc/ARCS/

MGcV: the microbial genomic context viewer for comparative genome analysis

Jit — Mon, 29 Jan 2018 04:55:46 -0600

MGcV is an interactive web-based visalization tool tailored to facilitate small scale genome analysis. To start using MGcV:

Supply your genes/genomic segments/phylogenetic tree of interest in the input-box by
- selecting the type of identifier and pasting identifiers (one per line)
- or by using the gene ID search tool
- or with the BLAST search tool
Click "Visualize context".

Consult the documentation to learn more about MGcV.

Address of the bookmark: http://mgcv.cmbi.ru.nl/

Ley Lab !

Fri, 11 Sep 2026 13:21:10 -0500

Research Program aims to elucidate how gut microbial species relate to genotypic differences between human individuals, to identify bacterial and archaeal species that share an evolutionary history with humans, and to determine the molecular basis of long-term host-microbial relationships. We approach these aims through a combination of population-level observations and laboratory-based molecular-level investigations. We link inter-microbial and microbial-host interactions at the molecular scale to patterns at population and evolutionary scales.

More at https://leylab.com/

Blobsplorer

Jit — Tue, 14 Jun 2016 10:28:58 -0500

Blobsplorer is a tool for interactive visualization of assembled DNA sequence data ("contigs") derived from (often unintentionally) mixed-species pools. It allows the simultaneous display of GC content, coverage, and taxonomic annotation for collections of contigs with a view to separating out those belonging to different taxa.

Blobsplorer is unlikely to be of use on its own as it requires contig data to be supplied in a format that involves considerable preprocessing (see below for a description). The easiest way to use Blobsplorer is as part of a workflow using scripts from here.

Address of the bookmark: http://nematodes.org/martin/blobsplorer/blobsplorer.html

Graph Genome Suite

Jit — Fri, 28 Oct 2016 07:59:54 -0500

Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the Graph Genome Suite — the most advanced population genomics tools in the world.

Address of the bookmark: https://www.sbgenomics.com/graph/

Rectangle Graph for Repeat Resolution in Genome Assembly

Rahul Nayak — Thu, 28 Dec 2017 09:43:03 -0600

Ultimate tool for resolving repeats in genome assemblies.

Though the specific implementation of the idea of the rectangle graph approach is already included into the current SPAdes distribution, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.

For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner. From de Bruijn Graphs to Rectangle Graphs for Genome Assembly, Lecture Notes in Bioinformatics 7534 (2012), pp. 249-261.

Address of the bookmark: http://bioinf.spbau.ru/en/rectangles

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph

Jit — Wed, 14 Nov 2018 04:50:27 -0600

MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accelerated version of MEGAHIT has been tested on NVIDIA GTX680 (4G memory) and Tesla K40c (12G memory) with CUDA 5.5, 6.0 and 6.5. MEGAHIT v1.0 or greater also supports IBM Power PC and has been tested on IBM POWER8.

https://academic.oup.com/bioinformatics/article/31/10/1674/177884

Address of the bookmark: https://github.com/voutcn/megahit

GraphUnzip: Phases an assembly graph using Hi-C data and/or long reads.

Jit — Fri, 05 Feb 2021 21:22:24 -0600

GraphUnzip, a fast, memory-efficient and accurate tool to unzip assembly graphs into their constituent haplotypes using long reads and/or Hi-C data. As GraphUnzip only connects sequences in the assembly graph that already had a potential link based on overlaps, it yields high-quality gap-less supercontigs. To demonstrate the efficiency of GraphUnzip, we tested it on a simulated diploid Escherichia coli genome, and on two real datasets for the genomes of the rotifer Adineta vaga and the potato Solanum tuberosum. In all cases, GraphUnzip yielded highly continuous phased assemblies.

https://www.biorxiv.org/content/biorxiv/early/2021/02/01/2021.01.29.428779.full.pdf

Address of the bookmark: https://github.com/nadegeguiglielmoni/GraphUnzip

GraphPath: A graph attention model for molecular stratification with interpretability based on the pathway-pathway interaction network

LEGE — Wed, 27 Mar 2024 20:51:21 -0500

Achieving accurate and interpretable clinical predictions requires paramount attention to thoroughly characterizing patients at both the molecular and biological pathway levels. In this paper, we present GraphPath, a biological knowledge-driven graph neural network with multi-head self-attention mechanism that implements the pathway-pathway interaction network. We train GraphPath to classify the cancer status of patients with prostate cancer based on their multi-omics profiling.

Address of the bookmark: https://github.com/amazingma/GraphPath