<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44472?offset=620</link>
	<atom:link href="https://bioinformaticsonline.com/related/44472?offset=620" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34814/bioinformatics-web-application-development-with-perl</guid>
	<pubDate>Tue, 26 Dec 2017 18:14:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34814/bioinformatics-web-application-development-with-perl</link>
	<title><![CDATA[Bioinformatics Web Application Development with Perl]]></title>
	<description><![CDATA[<div><p>Perl's second wave of adoption came from the growth of the world wide web. Dynamic web pages&mdash;the precursor to modern web applications&mdash;were easy to create with Perl and CGI. Thanks to Perl's ubiquity as a language for system administrators and its power to manipulate text, it was the default choice for web programming. Its presence everywhere made it popular and, in some ways, the duct tape of the Internet.</p><h4>Web Application Development</h4><p>The old days of CGI programs and the simple development style that represented seem clunky. Web pages have become web applications. Development has moved from generating static HTML to both client and server side programming, with rich client interfaces and powerful backends.</p><p>Perl is still well suited for developing modern web apps. The language grows more powerful and easier to use every year, the available libraries are wonderful and keep getting better, and the inventions and discoveries available in modern Perl are unsurpassed.</p><p>In particular, a modern Perl developer can do amazing things with modern Perl tools. If you still think of Perl web development as a&nbsp;<em>cgi-bin</em>&nbsp;directory full of messy scripts that spew warnings to STDERR, you're a decade out of date. Better yet, you can replace that mess piecemeal, thanks to the new tools and techniques of modern Perl. See, for example, the ever-growing list of technologies&nbsp;<a href="http://www.builtinperl.com/">Built in Perl</a>.</p><h4>Modern Perl Web Frameworks</h4><p>While the old wave of web development may have made the CGI.pm module central, modern Perl web programming follows a stricter separation of business logic, URL and request routing, and output. The days of slinging a string here, an array there, a Perl hash yonder, declaring every variable at the top of the program, and maybe making a subroutine are gone. The Perl world has seen the value of abstraction and ways to mechanize away boilerplate. Perl has dozens of frameworks and toolkits designed to make web development and deployment simpler.</p><p>Any of a dozen of these frameworks will help you do great things, but three in particular stand out. You can build web sites and web applications of tremendous value with all three. These are neither the only good possibilities (think of POE or Jifty or Continuity or...) nor the only mechanisms for web programming with Perl (see Mechanize or LWP or Mojo::UserAgent for more). Yet if you want three good options to choose between, start here.</p><h4>Catalyst</h4><p>The&nbsp;<a href="http://catalystframework.org/">Catalyst</a>&nbsp;framework is a flexible and powerful system for building small to large web apps. It uses the&nbsp;<a href="http://moose.perl.org/">Moose</a>&nbsp;object system to provide great APIs for extension and further development. It's the most mature of the modern top Perl web frameworks, yet it retains its flexibility and vibrancy. In particular, its plugin and extension ecosystem allows it to evolve to provide new and essential features.</p><p>Catalyst has embraced the Plack/PSGI standard for Perl web deployment and recent versions are exploring high-scalability, event-based request handling models.</p><h4>Dancer</h4><p>The&nbsp;<a href="http://perldancer.org/">Dancer</a>&nbsp;framework is deliberately minimal in syntax and scope, but it also has a vibrant plugin ecosystem. Dancer particularly excels for smaller sites and applications, though good programmers can build larger things with it.</p><p>The first version of Dancer was easy to use. Dancer 2 continues that ease while improving the internals and robustness of applications.</p><h4>Mojolicious</h4><p>The&nbsp;<a href="http://mojolicio.us/">Mojolicious</a>&nbsp;(Mojo) framework has a real-time design based on high performance event handling. Its focus is solving new and interesting problems in simple and effective ways, and the project has produced a lot of new code that does old things in better ways.</p><p>In particular, Mojolicious goes to great lengths to support new web standards, such as CSS 3, web sockets, and HTTP 2.</p><p>Where Catalyst embraces the CPAN fully, Mojolicious by design provides most of what an average app might need in a single download. It's still fully compatible with the CPAN, but the intention is to provide good working defaults in a package that's easy to start with. Mojo's fans are quick to praise it as fun to develop.</p><p>A modern Perl web developer should be familiar with at least one of these frameworks.</p><h4>Modern Perl Storage Mechanisms</h4><p>Perl's venerable&nbsp;<a href="http://search.cpan.org/perldoc?DBI">DBI</a>&nbsp;module has been the focal point of database access since its invention. Its design allows it to provide the same interface to huge relational databases and flat files alike through its DBD extension mechanism. Yet the DBI by itself isn't the be-all, end-all of data storage and access in Perl.</p><h4>DBIx::Class</h4><p><a href="http://search.cpan.org/perldoc?DBIx::Class">DBIx::Class</a>&nbsp;sits on top of DBI to provide an API to your database based on the concept of queries and results. This is often sufficient to remove all but the most complicated of SQL from your code, leaving you to manipulate your business models instead of the small details of how a relational database works. The power and maintainability you receive is well the small cost of the learning curve.</p><p>Even better, DBIC can manage (and even generate) your database schema for you.</p><p>Recent versions of DBIC have demonstrated that a well-written ORM can perform much better than even clever hand-written code. Because it builds on the Perl DBI, it scales everywhere from SQLite to PostgreSQL, MySQL, Oracle, and more.</p><h3>Rose::DB</h3><p>The lesser-known but no less powerful&nbsp;<a href="http://search.cpan.org/perldoc?Rose::DB::Object">Rose::DB::Object</a>&nbsp;builds on&nbsp;<a href="http://search.cpan.org/perldoc?Rose::DB">Rose::DB</a>&nbsp;to provide an object-relational mapper for Perl. While its high level features most directly compare to those of DBIx::Class, it's often measurably faster.</p><h4>NoSQL on the CPAN</h4><p>Of course the&nbsp;<a href="http://search.cpan.org/">CPAN</a>&nbsp;has modules for almost any NoSQL database or job queue or persistence mechanism you could name, and several you have never heard of. Everything you need is a quick CPAN or cpanm away!</p><h4>Modern Perl Deployment Strategies</h4><p>In the early days of the web, deploying a Perl web application meant putting one or more&nbsp;<em>.cgi</em>&nbsp;or&nbsp;<em>.pl</em>&nbsp;files in a special directory and hoping that your system administrator had everything configured correctly. The execution model was often slow and cumbersome, and accessing shared resources such as databases was often tricky.</p><p>Modern Perl has better choices. While deployment strategies are the source of many arguments, the return on your investment from learning the modern way is impressive.</p><h4>Plack/PSGI</h4><p>The PSGI specification (as exemplified by&nbsp;<a href="http://plackperl.org/">Plack</a>) describes a strategy for building Perl web apps independent of server and with the possibility to share custom processing behaviors.</p><p>In other words, it's a standard for writing Perl apps to take advantage of the huge ecosystem of Perl development available on the CPAN without tying yourself to a server like Apache, Apache 2, nginx, or anything else.</p><p>Any good modern Perl web framework (including those listed here) supports PSGI. Several deployment mechanisms exist to meet various business needs which also support PSGI. In particular, you can deploy the same application with a local testing server on your own machine as you can to your production server or servers without changing your application at all.</p><h4>mod_perl</h4><p>The older but still viable mod_perl Apache httpd module embeds Perl into the web server. This was the first widespread persistence mechanism for Perl web applications themselves and it's still popular to this day, though PSGI compliance is often the choice for new development. (PSGI handlers to use mod_perl as the backend are available.)</p><p>Modern Perl developers should familiarize themselves with PSGI and the wealth of available Plack middleware.</p><h4>Perl Web Development</h4><p>Of course no discussion of Perl web development would be complete without mentioning the strength of the CPAN. Almost any project will benefit from the wealth of freely available libraries built to solve real problems. These distributions run the gamut from full-blown web frameworks and content management systems to APIs for web services, development tools, testing systems, and interfaces to document formats and external resources.</p><p>For example, if you need to write a web service which accepts JSON data and produces Excel spreadsheets, you can glue together a few CPAN distributions and get the job done early. If you need to consume XML from a remote service and emit a PDF, you're in luck.</p><p>Perl's prowess as a general purpose programming language as well as its flexibility and power in managing text and gluing systems together make it a wonderful fit for web development. The community's adoption of modern Perl standards such as PSGI and Plack only enhance your power.</p><p>Web application development in Perl is still viable, and modern Perl tools and techniques and libraries make it more powerful and pleasant than ever.</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/35552/the-brent-lab</guid>
  <pubDate>Fri, 09 Feb 2018 10:55:27 -0600</pubDate>
  <link></link>
  <title><![CDATA[The Brent Lab]]></title>
  <description><![CDATA[
<p>The Brent Lab is developing and applying computational methods for mapping gene regulation networks, modeling them quantitatively, and engineering new behaviors into them.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37257/asar-advanced-metagenomic-sequence-analysis-in-r</guid>
	<pubDate>Mon, 09 Jul 2018 05:20:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37257/asar-advanced-metagenomic-sequence-analysis-in-r</link>
	<title><![CDATA[ASAR: Advanced metagenomic Sequence Analysis in R]]></title>
	<description><![CDATA[<p><span>An interactive data analysis tool for selection, aggregation and visualization of metagenomic data is presented. Functional analysis with a SEED hierarchy and pathway diagram based on KEGG orthology based upon MG-RAST annotation results is available.</span></p>
<p><span><span>To read the manual, please click the link&nbsp;</span><a href="https://askarbek-orakov.github.io/ASAR/">https://askarbek-orakov.github.io/ASAR/</a></span></p><p>Address of the bookmark: <a href="https://github.com/Askarbek-orakov/ASAR" rel="nofollow">https://github.com/Askarbek-orakov/ASAR</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36197/bioinformatics-oneliner</guid>
	<pubDate>Tue, 10 Apr 2018 04:13:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36197/bioinformatics-oneliner</link>
	<title><![CDATA[Bioinformatics OneLiner]]></title>
	<description><![CDATA[<p>To remove all line ends (\n) from a Unix text file:</p><pre>sed ':a;N;$!ba;s/\n//g' filename.txt &gt; newfilename_oneline.txt</pre><p>To get average for a column of numbers (here the second column $2):</p><pre>awk '{ sum += $2; n++ } END { if (n &gt; 0) print sum / n; }'</pre><p>To get sequence length for all sequences in a fasta file:</p><pre>awk '/^&gt;/ {if (seqlen){print seqlen}; print ;seqlen=0;next; } { seqlen = seqlen +length($0)}END{print seqlen}' \<br />filename.fasta</pre><p>To copy (move, rename, etc) files based on their list in a text file:</p><pre>cat file_list.txt | while read line; do cp "$line" complete_dataset/"$line"; done</pre><p>To split bam files into sets with mapped and unmapped reads:</p><pre>samtools view -F4 sample.bam &gt; sample.mapped.sam<br />samtools view -f4 sample.bam &gt; sample.unmapped.sam</pre><p>To gzip all your fastq files using gnu parallel and gzip:</p><pre>parallel gzip ::: *.fastq</pre><p>To gzip all your fastq files using pigz:</p><pre>pigz *.fastq</pre><p>To count all sequences in a fasta file:</p><pre>grep "^&gt;" yourfile.fasta -c</pre><p>To count all sequences in all fasta files in your current directory:</p><pre>for a in *.fasta; do ls $a; grep "^&gt;" -c $a; done</pre><p>To keep only one copy of duplicated lines:</p><pre>awk '!seen[$0]++'</pre><p>To sum assembly size from SPAdes contigs.fasta or scaffolds.fasta file:</p><pre>grep "^&gt;" scaffolds.fasta | cut -f 4 -d '_' | paste -sd+ | bc</pre><p>To remove everything after the first space at each line, e.g. to to simplify fasta headers:</p><pre>cut -d' ' -f1 &lt; your_file</pre><p>To count reads in a all .fastq.gz files in your current folder (fast, using gnu parallel):</p><pre>parallel "echo {} &amp;&amp; gunzip -c {} | wc -l | awk '{d=\$1; print d/4;}'" ::: *.gz</pre><p>To count reads in a all .fastq.gz files in your current folder:</p><pre>zcat *.gz | echo $((`wc -l`/4))</pre><p>To count reads in a all .fastq files in your current folder:</p><pre>cat *.fastq | echo $((`wc -l`/4))</pre><p>To count base pairs in a all .fastq.gz files in your current folder:</p><pre>zcat *.fastq.gz | paste - - - - | cut -f 2 | tr -d '\n' | wc -c </pre><p>To split multifasta file into many fasta files:</p><pre>awk '/^&gt;/ {OUT=substr($0,2) ".fa"}; {print &gt;&gt; OUT; close(OUT)}' Input_File</pre><p>To convert Illumina FASTQ 1.3 to 1.8:</p><pre>sed -e '4~4y/@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghi/!"#$%&amp;'\''()*+,-.\/0123456789:;&lt;=&gt;?@ABCDEFGHIJ/' f.fastq</pre><p>To convert FASTQ to FASTA:</p><pre>sed -n '1~4s/^@/&gt;/p;2~4p' </pre><p>To get fastq read length distribution:</p><pre>cat reads.fastq | awk '{if(NR%4==2) print length($1)}' | sort | uniq -c</pre><p>To deinterleave interleaved fastq file:</p><pre>cat myf.fq | paste - - - - - - - - | tee &gt;(cut -f 1-4 | tr "\t" "\n" &gt; myfile_1.fq) | cut -f 5-8 | \<br />tr "\t" "\n" &gt; myf2.fq </pre><p>To filter and sort contig identifiers from SPAdes assembly (e.g. here lenght &gt;= 4000 + coverage &gt;=100):</p><pre>grep "^&gt;" scaffolds.fasta | sed s"/_/ /"g | awk '{ if ($4 &gt;= 4000 &amp;&amp; $6 &gt;= 100) print $0 }' | sort -k 4 -n | \<br />sed s"/ /_/"g</pre><p>To append something to all headers of your fasta files:</p><pre>sed 's/&gt;.*/&amp;YOURSTRING/' filename.fasta &gt; new_filename.fasta</pre><p>To replace/squeeze multiple adjacent spaces by only one space:&nbsp;</p><pre>tr -s " " &lt; file</pre><p>To filter fastq based on length (here larger than or equal to 21, but smaller than or equal to 25.</p><pre>cat your.fastq | paste - - - - | awk 'length($2)&nbsp; &gt;= 21 &amp;&amp; length($2) &lt;= 25' | sed 's/\t/\n/g' &gt; filtered.fastq</pre><p>To print difference between the last and first row in 5th column:</p><pre>awk '{if (!first){first=$5;}; last=$5;} END {print last-first}' myfile.txt</pre><p>To sample only 200 first bases from all sequences in a multifasta file (e.g. from assembly scaffolds.fasta file here):</p><pre>awk '/^&gt;/{ seqlen=0; print; next; } seqlen &lt; 200 { if (seqlen + length($0) &gt; 200) $0 = substr($0, 1, 200-seqlen);\<br /> seqlen += length($0); print }' scaffolds.fasta &gt; 200bp_scaffolds.fasta</pre><p>&nbsp;To pipe a compressed fasta file directly into makeblastdb.</p><pre>gunzip -c fasta.gz | makeblastdb -in -</pre><p>To remove sequences with duplicate fasta headers from a fasta file.</p><pre>awk '/^&gt;/{f=!d[$1];d[$1]=1}f' in.fasta &gt; out.fasta</pre>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</guid>
	<pubDate>Mon, 26 Aug 2019 18:07:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</link>
	<title><![CDATA[LRSDAY: Long-read Sequencing Data Analysis for Yeasts]]></title>
	<description><![CDATA[<p><span>Long-read sequencing technologies have become increasingly popular in genome projects due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast,&nbsp;</span><em>Saccharomyces cerevisiae</em><span>, has many isolates currently being sequenced with long reads.&nbsp;</span></p><p>Address of the bookmark: <a href="https://github.com/yjx1217/LRSDAY" rel="nofollow">https://github.com/yjx1217/LRSDAY</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36384/binding-site-prediction-in-protein</guid>
	<pubDate>Wed, 25 Apr 2018 04:35:57 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36384/binding-site-prediction-in-protein</link>
	<title><![CDATA[Binding Site Prediction in Protein !]]></title>
	<description><![CDATA[<p><span>The interaction between proteins and other molecules is fundamental to all biological functions. In this section we include tools that can assist in prediction of interaction sites on protein surface and tools for predicting the structure of the intermolecular complex formed between two or more molecules (docking).</span></p><h4>Pockets Identification</h4><p><a href="http://sts.bioengr.uic.edu/castp/" target="_blank">CASTp</a></p><div style="text-align: justify;">Automatic Identification of pockets and cavities in proteins structure, and quantitation of their volumes using Delaunay triangulation. Available also as PyMOL plugin</div><p><a href="http://www.bioinformatics.leeds.ac.uk/pocketfinder/" target="_blank">Pocket-Finder</a></p><div style="text-align: justify;">Automatic identification of pockets and cavities in proteins structure, and quantitation of their volumes.</div><p><a href="http://gecco.org.chemie.uni-frankfurt.de/pocketpicker/index.html" target="_blank">PocketPicker</a></p><div style="text-align: justify;">Grid-based technique for the analysis of protein pockets. PocketPicker available as a plugin for&nbsp;<a href="https://bip.weizmann.ac.il/toolbox/structure/pymol.htm">PyMOL</a></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><h4>Binding Site Prediction</h4>
<p><a href="http://consurf.tau.ac.il/" target="_blank">ConSurf</a></p>
</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">Identification of functional regions in proteins by surface-mapping of phylogenetic information</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><a href="http://www-cryst.bioc.cam.ac.uk/~crescendo/crescendo.php" target="_blank">CRESCENDO</a></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">Identification protein interaction sites. It uses sequence conservation patterns in homologous proteins to distinguish between residues that are conserved due to structural restraints from those due to functional restraints.&nbsp;&nbsp;</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><strong>Ligand Binding Sites</strong></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><a href="http://www.sbg.bio.ic.ac.uk/~3dligandsite/" target="_blank">3DLigandSite</a></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">The server utilizes protein-structure prediction to provide structural models of the binding site. Ligands bound to structures are superimposed onto the model and use to predict the binding site.</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">F<a href="http://cssb.biology.gatech.edu/skolnick/files/FINDSITE/" target="_blank">INDSITE</a></div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">A threading-based method for ligand-binding site prediction and functional annotation based on binding-site similarity across superimposed groups of threading templates.</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">
<p><a href="http://scoppi.biotec.tu-dresden.de/pocket/" target="_blank">LIGSITE<sup>csc</sup></a></p>
<div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;">Prediction of binding site by pocket identification using the Connolly surface and degree of conservation</div>
<p><a href="http://metapocket.eml.org/" target="_blank"></a></p>
</div><div style="text-align: justify;">&nbsp;</div><div style="text-align: justify;"><a href="http://metapocket.eml.org/" target="_blank">metaPocket</a>A meta server for ligand-binding site prediction. metaPocket use&nbsp;<a href="https://bip.weizmann.ac.il/toolbox/structure/binding.htm#ligsite">LIGSITE<sup>csc</sup></a>,&nbsp;<a href="https://bip.weizmann.ac.il/toolbox/structure/binding.htm#pass">PASS</a>,&nbsp;<a href="https://bip.weizmann.ac.il/toolbox/structure/binding.htm#qsite">Q-SiteFinder</a>&nbsp;and&nbsp;<a href="http://www.biochem.ucl.ac.uk/~roman/surfnet/surfnet.html" target="_blank">SURFNET</a></div>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</guid>
	<pubDate>Sun, 20 Dec 2020 11:43:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</link>
	<title><![CDATA[BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks]]></title>
	<description><![CDATA[<p>With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface</p>
<p>BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.</p><p>Address of the bookmark: <a href="https://amp.pharm.mssm.edu/biojupies/" rel="nofollow">https://amp.pharm.mssm.edu/biojupies/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37590/parallel-processing-with-perl</guid>
	<pubDate>Sat, 25 Aug 2018 11:32:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37590/parallel-processing-with-perl</link>
	<title><![CDATA[Parallel Processing with Perl !]]></title>
	<description><![CDATA[<p>Here is a small tutorial on how to make best use of multiple processors for bioinformatics analysis. One best way is using perl threads and forks. Knowing how these threads and forks work is very important before implementing them. Getting to know how these work would be really useful before reading this tutorial.</p><p>Many times in bioinformatics we need to deal with huge datasets which&nbsp; are more than 100GB size. The traditional way to analysis a file is using the while loop</p><p>while (FILE){</p><p>Do something;</p><p>}</p><p>This is very slow(since we are using only one processor) and if we have 500 million lines in the dataset it takes more than a day to iterate through the whole dataset. So how do we make best use of all our processors and get the work done quickly?</p><p>Here is a very simple and efficient technique with perl which i have been using. I am&nbsp; more inclined towards using perl fork than perl threads.</p><p>One of the oldest way to fork is</p><blockquote><p>my $fork = fork();<br />if($fork){&nbsp;&nbsp;&nbsp;<br />push (@childs,$fork);&nbsp;<br />}<br />elseif($fork==0){<br /><strong>your code here;</strong><br />exit(0);<br />}<br />else{die &ldquo;Couldnt fork : $!&rdquo;;}</p><p>## wait for the child process to finish<br />foreach(@childs){<br />my $tmp=waitid($_,0);<br />}</p></blockquote><p>what a fork does is it creates a child process and takes the variables and code with it to analyze it separately (detached from the parent process) and thus a separate process is created( which usually runs on a separate processor). Thats it!! One big disadvantage of forking is its very difficult to share variables among the different processes. I will show you how to do it easily but still it has its own drawbacks.</p><blockquote><p>Okie, now if you really do not want to use fork in your code, that&rsquo;s okie too..There are many useful modules which do it for you very efficiently. One really useful module is Parallel::ForkManager. You can use Parallel::ForkManager to manage the number of forks you want to generate (number of processors you want to use).</p><p><strong>Simple usage:</strong><br />use Parallel::ForkManager;<br />my $max_processors=8;<br />my $fork= new Parallel::ForkManager($max_processors);<br />foreach (@dna) {<br />$fork-&gt;start and next; # do the fork<br /><strong>you code here;</strong><br />$fork-&gt;finish; # do the exit in the child process<br />}<br />$pm-&gt;wait_all_children;</p></blockquote><p>so you will be generating 8 forks which do the same thing for your each element of array. when one child finishes, Parallel::ForkManager generates a new one and thus you will be using all your processors to analyze the data. Now, if you have generated 8 child processes and want to write the data to one file. You need to lock the file to do this, because you will have problems with the buffering. You can lock the file using flock command.</p><blockquote><p>open (my $QUAL, &ldquo;myfile.txt&rdquo;);<br />flock $QUAL, LOCK_EX or die &ldquo;cant lock file $!&rdquo;;<br />print $QUAL &ldquo;$output&rdquo;;<br />flock $QUAL, LOCK_UN or die &ldquo;$!&rdquo;;<br />close $QUAL;</p></blockquote><p>I would not suggest using flock when dealing with multiple processes because it will decrease the processing efficiency( each child process must wait for the lock to be released by the other child process). Instead, I would suggest each fork writing to a separate file and after the processing just concatenating them.</p><p><strong>Putting it all together, If you have 100GB data you can do this</strong></p><blockquote><p><strong>step 1</strong>&nbsp;: split the dataset equally according to number of processors you have. this may take a few hours(about 2-3 hrs for 100GB file)<br />You can use unix &ldquo;split&rdquo; command for this<br />for example:<br />my $number_split=int($number_of_entries_in_your_dataset/$max_processors);<br />my $split_Files=`split -l $number_split &ldquo;your_file.fasta&rdquo; &ldquo;file_name&rdquo;`;</p><p><strong>step2</strong>: open you directory comtaining you split files and start Parallel::ForkManager.<br /><strong>For example:</strong><br />opendir(DIRECTORY, $split_files_directory) or die $!; ### open the directory<br />my $fork= new Parallel::ForkManager($max_processors);<br />while (my $file = readdir(DIRECTORY)) { ### read the directory<br />if($file=~/^\./){next;}<br />print $file,&rdquo;\n&rdquo;;<br />########## Start fork ##########<br />my $pid= $super_fork-&gt;start and next;<br /><strong>Whatever you want to do with the split file ;</strong><br /><strong>analyze my piece of $file;</strong><br />######### end fork ###############<br />$super_fork-&gt;finish;<br />}<br />$super_fork-&gt;wait_all_children;</p></blockquote><p>So basically each processor will be active with its piece of data (split file) and thus you have created 8 processes at one time which run without interfering with the other process. I again will not suggest writing output from each child process to one file(for reasons above). Write output from each fork to a separate file and finally concatenate them. Thats it, you have just increased your program speed by 8 times!! Isnt it easy?</p><p><strong>Note:</strong><br />You may worry about concatenation of the output each child generates, since it does take some time(remember 100GB). I think now you can use a mysql database LOAD DATA LOCAL INFILE command to load all the files into a single table(Should take about 3hrs for 100Gb dataset) and then export the whole table into one file. This should be faster than just concatenating them using &ldquo;cat&rdquo; command.(correct me if I am wrong)</p><p>Or much simpler way is to use pipes</p><p>cat output_dir/* | my_pipe or my_pipe &lt;(file1) final_file;</p><p>Thats it guys!! Enjoy programming and please do comment. I am not a computer scientist so forgive me for any mistakes and if any please report them. Thank you.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/38302/senior-bioinformatics-scientist-at-elucidata</guid>
  <pubDate>Tue, 27 Nov 2018 04:05:57 -0600</pubDate>
  <link></link>
  <title><![CDATA[Senior Bioinformatics Scientist at Elucidata]]></title>
  <description><![CDATA[
<p>Key Responsibilities <br />- Process and analyse metabolomic, transcriptional, genomics, proteomics <br />and any other kind of biological data. <br />- Interpret the data in the context of relevant biological literature to generate <br />actionable insights. <br />- Communicate the findings from data and literature to biologists and use the <br />biological insights to derive next steps/analyses. <br />- Communicate work through blogs, meet-ups, research papers, posters, etc. <br />- Identify, troubleshoot, and implement improvements to existing pipelines <br />and algorithms. <br />- Identify and implement new tools and pipelines to use for different types of <br />biological data. <br />- Work in a multi-disciplinary team with biologists, data scientists and data <br />analysts. <br />- Help with any other requirements (from database design to generating <br />prototypes for the product team).</p>

<p>Requirements <br />- 3-5 years of relevant bioinformatics experience such as public data mining, <br />processing, analysing and visualising omics data, etc. <br />- Ph.D., Masters or Bachelors in Bioinformatics, Biotechnology, <br />Computational Biology, or related field. <br />- Understanding of molecular biology and biochemistry. <br />- Comfort and experience with biological research and data. <br />- Proficient in a programming language used for bioinformatics such as R or <br />python. <br />- Excellent communication skills. <br />- Ability to summarise and simplify complex analyses for a non-technical <br />audience. <br />- Strong analytical skills, curiosity and a knack to solve difficult problems. <br />- Work well in multi-disciplinary teams with people of vastly different <br />backgrounds. <br />- Demonstrated success in collaboration and independent work.</p>

<p>More at https://angel.co/elucidata/jobs/460104-senior-bioinformatics-scientist</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>

</channel>
</rss>