<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44497?</link>
	<atom:link href="https://bioinformaticsonline.com/related/44497?" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/29583/graph-genome-suite</guid>
	<pubDate>Fri, 28 Oct 2016 07:59:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/29583/graph-genome-suite</link>
	<title><![CDATA[Graph Genome Suite]]></title>
	<description><![CDATA[<p><span>Seven Bridges is the biomedical data analysis company accelerating breakthroughs in genomics research for cancer, drug development and precision medicine. We build self-improving systems to analyze millions of genomes, including the&nbsp;</span><strong>Graph Genome Suite</strong><span>&nbsp;&mdash; the most advanced population genomics tools in the world.</span></p><p>Address of the bookmark: <a href="https://www.sbgenomics.com/graph/" rel="nofollow">https://www.sbgenomics.com/graph/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43736/odgi-optimized-dynamic-genomegraph-implementation</guid>
	<pubDate>Tue, 01 Feb 2022 23:42:21 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43736/odgi-optimized-dynamic-genomegraph-implementation</link>
	<title><![CDATA[odgi: optimized dynamic genome/graph implementation]]></title>
	<description><![CDATA[<p dir="auto"><code>odgi</code>&nbsp;provides an efficient and succinct dynamic DNA sequence graph model, as well as a host of algorithms that allow the use of such graphs in bioinformatic analyses.</p>
<p dir="auto">Careful encoding of graph entities allows&nbsp;<code>odgi</code>&nbsp;to efficiently compute and transform&nbsp;<a href="https://pangenome.github.io/">pangenomes</a>&nbsp;with minimal overheads.&nbsp;<code>odgi</code>&nbsp;implements a dynamic data structure that leveraged multi-core CPUs and can be updated on the fly.</p>
<p dir="auto">The edges and path steps are recorded as deltas between the current node id and the target node id, where the node id corresponds to the rank in the global array of nodes. Graphs built from biological data sets tend to have local partial order and, when sorted, the deltas be small. This allows them to be compressed with a variable length integer representation, resulting in a small in-memory footprint at the cost of packing and unpacking.</p>
<p dir="auto">The RAM and computational savings are substantial. In partially ordered regions of the graph, most deltas will require only a single byte.</p><p>Address of the bookmark: <a href="https://github.com/pangenome/odgi" rel="nofollow">https://github.com/pangenome/odgi</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34925/rectangle-graph-for-repeat-resolution-in-genome-assembly</guid>
	<pubDate>Thu, 28 Dec 2017 09:43:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34925/rectangle-graph-for-repeat-resolution-in-genome-assembly</link>
	<title><![CDATA[Rectangle Graph for Repeat Resolution in Genome Assembly]]></title>
	<description><![CDATA[<p>Ultimate tool for resolving repeats in genome assemblies.</p>
<p>Though the specific implementation of the idea of the rectangle graph approach is already included into the&nbsp;<a href="http://bioinf.spbau.ru/spades">current SPAdes distribution</a>, we're also releasing the Rectangle Graph Module (RGM) as the separate code which can be run independently of SPAdes. Although RGM differs from the current implementation of the rectangle graph approach in SPAdes, in the future we plan to integrate RGM in SPAdes. RGM can be run with other genome assemblers if they use the graph format as SPAdes files.</p>
<p>For more details see: Nikolay Vyahhi, Son K. Pham, Pavel Pevzner.&nbsp;<a href="http://www.springerlink.com/content/e617788h25u36440/">From de Bruijn Graphs to Rectangle Graphs for Genome Assembly</a>,&nbsp;<em>Lecture Notes in Bioinformatics</em>&nbsp;7534 (2012), pp. 249-261.</p><p>Address of the bookmark: <a href="http://bioinf.spbau.ru/en/rectangles" rel="nofollow">http://bioinf.spbau.ru/en/rectangles</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40713/glia-a-graphsmith-waterman-partial-order-alignerrealigner</guid>
	<pubDate>Tue, 28 Jan 2020 04:02:58 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40713/glia-a-graphsmith-waterman-partial-order-alignerrealigner</link>
	<title><![CDATA[Glia: a Graph/Smith-Waterman (partial order) aligner/realigner]]></title>
	<description><![CDATA[<p><span>glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://github.com/ekg/glia">https://github.com/ekg/glia</a></span></p>
<pre><code>glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA</code></pre><p>Address of the bookmark: <a href="https://github.com/ekg/glia" rel="nofollow">https://github.com/ekg/glia</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37223/chopstitch-exon-annotation-and-splice-graph-construction-using-transcriptome-assembly-and-whole-genome-sequencing-data</guid>
	<pubDate>Tue, 03 Jul 2018 04:14:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37223/chopstitch-exon-annotation-and-splice-graph-construction-using-transcriptome-assembly-and-whole-genome-sequencing-data</link>
	<title><![CDATA[ChopStitch: exon annotation and splice graph construction using transcriptome assembly and whole genome sequencing data]]></title>
	<description><![CDATA[ChopStitch is a new method for finding putative exons and constructing splice graphs using an assembled transcriptome and whole genome shotgun sequencing (WGSS) data. ChopStitch identifies exon-exon boundaries in de novo assembled RNA-seq data with the help of a Bloom filter that represents the k-mer spectrum of WGSS reads. The algorithm also detects base substitutions in transcript sequences corresponding to sequencing or assembly errors, haplotype variations, or putative RNA editing events. The primary output of our tool is a FASTA file containing putative exons. Further, exon edges are interrogated for alternative exon-exon boundaries to detect transcript isoforms, which are reported as splice graphs in dot output format.<p>Address of the bookmark: <a href="https://github.com/bcgsc/ChopStitch" rel="nofollow">https://github.com/bcgsc/ChopStitch</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40711/vg-variation-graph-data-structures-interchange-formats-alignment-genotyping-and-variant-calling-methods</guid>
	<pubDate>Tue, 28 Jan 2020 03:53:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40711/vg-variation-graph-data-structures-interchange-formats-alignment-genotyping-and-variant-calling-methods</link>
	<title><![CDATA[VG: variation graph data structures, interchange formats, alignment, genotyping, and variant calling methods]]></title>
	<description><![CDATA[<p><em>Variation graphs</em>&nbsp;provide a succinct encoding of the sequences of many genomes. A variation graph (in particular as implemented in vg) is composed of:</p>
<ul>
<li><em>nodes</em>, which are labeled by sequences and ids</li>
<li><em>edges</em>, which connect two nodes via either of their respective ends</li>
<li><em>paths</em>, describe genomes, sequence alignments, and annotations (such as gene models and transcripts) as walks through nodes connected by edges</li>
</ul><p>Address of the bookmark: <a href="https://github.com/vgteam/vg" rel="nofollow">https://github.com/vgteam/vg</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44182/collection-of-graph-visualization-tools</guid>
	<pubDate>Wed, 25 Jan 2023 02:57:42 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44182/collection-of-graph-visualization-tools</link>
	<title><![CDATA[Collection of Graph Visualization tools !]]></title>
	<description><![CDATA[<p>Standard approaches to genome inference and analysis relate sequences to a single linear reference genome. This is efficient but has a fundamental problem: Differences from this reference are hard to observe and describe in a coherent way. Variation and sequence are separated.</p>
<p><a href="https://pangenome.github.io/images/genomic-vs-pangenomic-analysis.png"><img src="https://pangenome.github.io/images/genomic-vs-pangenomic-analysis.png" alt="image" width="45%" style="border: 0px; border: 0px;"></a><span>&nbsp;</span><a href="https://pangenome.github.io/images/genomic-vs-pangenomic-models.png"><img src="https://pangenome.github.io/images/genomic-vs-pangenomic-models.png" alt="image" width="54%" style="border: 0px; border: 0px;"></a></p>
<p><a href="https://fungidb.org/fungidb/app/downloads/Current_Release/GultimumBR650/" target="_blank">https://fungidb.org/fungidb/app/downloads/Current_Release/GultimumBR650/</a></p><p>Address of the bookmark: <a href="https://pangenome.github.io/" rel="nofollow">https://pangenome.github.io/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41231/phd-student-bio-informatician-in-computational-protein-modeling</guid>
  <pubDate>Sun, 23 Feb 2020 03:46:46 -0600</pubDate>
  <link></link>
  <title><![CDATA[PhD student / Bio-informatician in computational protein modeling]]></title>
  <description><![CDATA[
<p>PhD student / Bio-informatician in computational protein modeling<br />Job Profile<br />You will perform research on drug/protein interaction analysis in the context of lung cancer, using computational protein modeling. You will implement existing models predicting drug efficacy, related to EGFR-driven cancer. You will translate these models to novel oncogenes, including ROS1. You will validate these models against experimental data from a parallel project, with the final goal of deployment of your methods into clinical decision making. Your work will be embedded in an international network consisting of both academic partners and ROS1-NSCLC patient organizations.</p>

<p>Requirements</p>

<p>You are (or soon will be) a master in bio-informatics. You have strong ICT skills and you are eager to fully submerge into the world of protein modeling. You have good experience with Linux and one or more programming languages as well as knowledge of tertiary structure analysis. Candidates with a Master degree in one of the life sciences (Biomedical sciences, Biochemistry, Bio-engineering, Biostatistics, …), with relevant interest and extended experience in this field are also welcome. A general background cancer biology and genetics is needed. You are willing and eligible to apply for a personal PhD fellowship with the Flemish FWO (FWO.be). Therefore, it is required that you hold a master degree from a European university, and have not obtained your master diploma more than three years ago (see FWO website for detailed conditions). Proficiency in English, and good communication skills, both oral and written, are required. You are highly motivated, and you like to work in an interactive research team. You are willing to work on a 4-year PhD project starting beginning of 2020.</p>

<p>What we offer</p>

<p>We offer a one year position, as a PhD student, which can be extended up to 4 year upon positive evaluation, even if a personal fellowship application is not successful. Wages are according to the standard Flemish bursary levels for PhD students.</p>

<p>Interested?<br />For additional information please contact dr. Geert Vandeweyer. To apply, send a copy of your CV including details of your relevant skills and a motivation letter by e-mail to dr. Geert Vandeweyer (geert.vandeweyer@uantwerpen.be) before March 15, 2020.</p>

<p>Source:https://academicpositions.be/ad/university-of-antwerp/2020/phd-student-bio-informatician-in-computational-protein-modeling/141252?utm_source=jooble&amp;utm_medium=cpc&amp;utm_campaign=jooble</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/44226/rotifers-lab</guid>
  <pubDate>Wed, 08 Mar 2023 23:23:14 -0600</pubDate>
  <link></link>
  <title><![CDATA[Rotifers Lab]]></title>
  <description><![CDATA[
<p>For scientists in the MBL’s Gribble Lab, the rotifer (Brachionus manjavacas) is used as a model organism to study evolution, stress responses, the biology of aging, and maternal effects. Rotifers are small, easy to grow in the lab, have a short lifespan, and share many of their genes with humans. That makes them ideal specimens in which to address questions relevant to human health as well as understand basic biological and evolutionary processes. Brachionus rotifers produces eggs that can be completely dried and frozen for decades, then hatch within a day when exposed to water and light.</p>

<p>https://www.mbl.edu/research/research-organisms/rotifer<br />https://gribblebiolab.org/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/29620/hybpiper</guid>
	<pubDate>Fri, 04 Nov 2016 05:02:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/29620/hybpiper</link>
	<title><![CDATA[HybPiper]]></title>
	<description><![CDATA[<p>HybPiper was designed for targeted sequence capture, in which DNA sequencing libraries are enriched for gene regions of interest, especially for phylogenetics. HybPiper is a suite of Python scripts that wrap and connect bioinformatics tools in order to extract target sequences from high-throughput DNA sequencing reads.</p>
<p>Targeted bait capture is a technique for sequencing many loci simultaneously based on bait sequences. HybPiper pipeline starts with high-throughput sequencing reads (for example from Illumina MiSeq), and assigns them to target genes using BLASTx or BWA. The reads are distributed to separate directories, where they are assembled separately using SPAdes. The main output is a FASTA file of the (in frame) CDS portion of the sample for each target region, and a separate file with the translated protein sequence.</p>
<p>HybPiper also includes post-processing scripts, run after the main pipeline, to also extract the intronic regions flanking each exon, investigate putative paralogs, and calculate sequencing depth. For more information,&nbsp;<a href="https://github.com/mossmatters/HybPiper/wiki/">please see our wiki</a>.</p>
<p>HybPiper is run separately for each sample (single or paired-end sequence reads). When HybPiper generates sequence files from the reads, it does so in a standardized directory hierarchy. Many of the post-processing scripts rely on this directory hierarchy, so do not modify it after running the initial pipeline. It is a good idea to run the pipeline for each sample from the same directory. You will end up with one directory per run of HybPiper, and some of the later scripts take advantage of this predictable directory structure.</p><p>Address of the bookmark: <a href="https://github.com/mossmatters/HybPiper" rel="nofollow">https://github.com/mossmatters/HybPiper</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>