<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44581?offset=740</link>
	<atom:link href="https://bioinformaticsonline.com/related/44581?offset=740" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/22068/binc-examination-2015</guid>
	<pubDate>Fri, 17 Apr 2015 03:34:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/22068/binc-examination-2015</link>
	<title><![CDATA[BINC examination 2015 !!!]]></title>
	<description><![CDATA[<p>BioInformatics National Certification (BINC) Examination 2015 organized by Department of Biotechnology, Government of India, New Delhi Pondicherry University, Puducherry</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/22068" length="281577" type="application/pdf" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22234/national-institute-of-biologicals-recruitment-2015</guid>
  <pubDate>Mon, 27 Apr 2015 19:44:45 -0500</pubDate>
  <link></link>
  <title><![CDATA[National Institute of Biologicals Recruitment 2015]]></title>
  <description><![CDATA[
<p>National Institute of Biologicals (NIB), Noida<br />Job Code: 260415(04)Y</p>

<p>National Institute of Biologicals (NIB), Noida invites applications to recruit on vacant posts of Scientist, Training Officer, Administrative Assistant, Stenographer, Junior Engineer, Computer Operator etc. Applications against these Government Jobs can be submitted on or before 01 July 2015.</p>

<p>NIB Vacancy 2015 Details<br />1. Scientist Grade III – 06<br />Qualification: PG degree in the concern field.<br />Age Limit: 35 Years</p>

<p>2. Junior Scientist – 07<br />Qualification: M.Sc. in Microbiology / Clinical Microbiology / Biotechnology/ Bioinformatics/ Biochemistry/Bacteriology/Pharmacology/ Serology / Molecular Biology/Physiology from any recognized University with at least 60% marks.<br />Age Limit: 30 Years</p>

<p>How to Apply: Duly filled-in applications in prescribed application format along with copies of required documents should be reach to: Administrative Officer, National Institute of Biologicals (Ministry of Health &amp; Family Welfare), A-32, Sector-62, Institutional Area, Noida-201309. Click here to obtain application form.</p>

<p>The Last Date to apply to NIB Job is 01 July 2015.</p>

<p>Click here to view details http://nib.gov.in/Advt%20%20%2824.04.2015%29.pdf</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22429/walk-ins-for-jrf-ans-srf-post-in-nirrh-mumbai</guid>
  <pubDate>Thu, 28 May 2015 19:04:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[Walk-ins for JRF ans SRF post in NIRRH, Mumbai]]></title>
  <description><![CDATA[
<p>Title of project- "EXPLORING THE HINGE AND TRANSMEMBRANE REGION OF HUMAN FSHR FOR DESIGN OF SMALL MOLECULE AND PEPTIDOMIMETIC MODULATORS"<br />Name of the Post- Junior Research Fellow<br />No. of vacancy- One<br />Stipend- Rs. 25000/ +30% HRA<br />Essential qualification- Candidate should be Post Graduate Degree in Life Sciences / Bioinformatics /Pharmacology/ Chemistry or any other relevant area of Biology or Graduate Degree in Professional Course with NET qualification or Post Graduate Degree in Professional Course.<br />Desirable- Candidate with Good knowledge of protein structures, docking, MD simulations will be preferred.<br />Age Limit- Not exceeding 28 Years<br />Duration of project- Upto May 2018</p>

<p>Title of project- "Analysis of the structures of known antimicrobial peptides using machine learning algorithms and molecular dynamics simulations".<br />Name of the Post- Senior Research Fellow<br />No. of vacancy- One<br />Stipend- Rs. 14000/ +30% HRA<br />Essential qualification- Candidate should be having M.Sc. degree in Life Sciences / Bioinformatics / Pharmacology/ Chemistry or any other relevant area of Biology and 2 years of research experience.<br />Desirable- Candidate with Good knowledge of protein structures, docking, MD simulations will be preferred.<br />Age Limit- Not exceeding 35 Years<br />Duration of project- Upto April 2016<br />How to Apply- Interested candidates can download the application form from below mentioned link- http://www.nirrh.res.in/links/BiodataForm.pdf<br />Candidate must bring the filled up application form along with all the relevant documents in original and one set of attested photocopies of the same and one passport size recent colour photograph.</p>

<p>Ref. - http://www.nirrh.res.in/links/job_jrf-srf.htm</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22287/research-fellows-at-aimscs-hyderabad</guid>
  <pubDate>Wed, 06 May 2015 06:23:33 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Fellows at AIMSCS, Hyderabad]]></title>
  <description><![CDATA[
<p>C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS) - Hyderabad, Andhra Pradesh<br />Advertisement No.: 5/2015</p>

<p>Research Fellows Systems Biology job vacancy in C.R.Rao Advanced Institute of Mathematics, Statistics and Computer Science (AIMSCS)</p>

<p>JRF : Qualification - M. Sc in Bioinformatics, Systems Biology, M. Sc statistics, or M. Tech in Bioinformatics,</p>

<p>Pay Scale : Rs. 25,000</p>

<p>SRF : Qualification- Qualification prescribed for JRF with 2 years of research experience.</p>

<p>Pay Scale : Rs. 28,000*</p>

<p>No.of Post: 2</p>

<p>Desirable: Candidates should have strong background in Computational biology, bioinformatics, statistics and algorithmic development. In addition to that previous experience of working on Linux, bio-informatics, NGS data analysis and Basic knowledge of biology is desirable. Programming on any one of the programming languages (C, C++, perl, python) and statistical framework (e.g. R, matlab, etc.) is highly desirable.</p>

<p>More at http://www.crraoaimscs.org/jrf_application_form_2015.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22403/ryan-e-mills-lab</guid>
  <pubDate>Tue, 26 May 2015 09:29:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Ryan E. Mills Lab]]></title>
  <description><![CDATA[
<p>Our research group is primarily focused on the analysis of whole genome sequence data to identify genetic variation (primarily structural variation) and examine their potential functional impact in disease phenotypes. We are particularly interested in analyzing complex regions of the genome that are not easily resolved through modern sequencing approaches and which may exhibit interesting mechanistic origins.</p>

<p>We are also interested in the large-scale integration of genomic, expression, methylation and proteomic data sets, as well as the application of whole genome sequence analysis in clinical diagnostics. </p>

<p>More at http://millslab.ccmb.med.umich.edu/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/22416/rosenberg-lab</guid>
  <pubDate>Wed, 27 May 2015 17:52:24 -0500</pubDate>
  <link></link>
  <title><![CDATA[Rosenberg lab]]></title>
  <description><![CDATA[
<p>Research. Research in the lab focuses on mathematical, statistical, and computational problems in evolutionary biology and human genetics. Long-term interests of the lab include topics such as:</p>

<p>    Human genetic variation<br />    Inference of human evolutionary history from genetic markers<br />    Statistical analysis of population-genetic data<br />    Mathematical models of gene genealogies<br />    Theoretical population genetics<br />    Combinatorics of evolutionary trees<br />    The relationship between gene trees and species trees<br />    The role of human evolutionary genetics in the search for genes that contribute to disease-susceptibility <br />More at https://web.stanford.edu/group/rosenberglab/index.html</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22437/jrf-bioinformatics-icar-national-research-centre-for-orchids-pakyong</guid>
  <pubDate>Thu, 28 May 2015 19:33:19 -0500</pubDate>
  <link></link>
  <title><![CDATA[JRF Bioinformatics @ ICAR - National Research Centre for Orchids  Pakyong]]></title>
  <description><![CDATA[
<p>ICAR - National Research Centre for Orchids</p>

<p>Pakyong</p>

<p>F.No:NRCO/Admn/DBT /136 /</p>

<p>Walk-in-Interviews will be held at 737106, Sikkim for the post of 01 (One Project ‘DBT’s Twinning programme for the NE’ titled “Assessment of some fragrant orchids of north-east India for sustainable improvement of community livelihood”, indicated below. The appointment will be on contractual basis and the incumbents shall not have any regular appointment in ICAR.</p>

<p>‘DBT’s Twinning programme for the NE’ titled “Assessment of chemical and genetic divergence of some fragrant orchids of north-east India for sustainable improvement of community livelihood”</p>

<p>Junior Research Fellow (One post)</p>

<p>Essential Qualification : a. MSc (with NET qualification) / M.Tech degree (with or without NET) with minimum 55% marks in Biotechnology/ Bioinformatics/ Molecular Biology or any other related field.</p>

<p>Desirable Qualification: Computer Skills (Linux, Perl, Java, MySQL) with experience in advanced molecular Biology techniques</p>

<p>2nd June 2015</p>

<p>Advertisement: www.nrcorchids.nic.in/Employments/Vacancy%20-%20JRF.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>