<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44614?offset=90</link>
	<atom:link href="https://bioinformaticsonline.com/related/44614?offset=90" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43315/genome-assembly-workshop-2020</guid>
	<pubDate>Wed, 25 Aug 2021 04:30:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43315/genome-assembly-workshop-2020</link>
	<title><![CDATA[Genome Assembly Workshop 2020]]></title>
	<description><![CDATA[<p><span>Our team offers custom bioinformatics services to academic and private organizations. We have a strong academic background with a focus on cutting edge, open source software. We replicate standard analysis pipelines (best practices) when appropriate, and/or develop novel applications and pipelines when needed, however we always emphasize biological interpretation of the data.</span></p>
<p><span>More at&nbsp;https://ucdavis-bioinformatics-training.github.io/</span></p><p>Address of the bookmark: <a href="https://ucdavis-bioinformatics-training.github.io/2020-Genome_Assembly_Workshop/snakemake/snakemake_intro" rel="nofollow">https://ucdavis-bioinformatics-training.github.io/2020-Genome_Assembly_Workshop/snakemake/snakemake_intro</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43587/fix-rewritable-error-of-elgg</guid>
	<pubDate>Mon, 15 Nov 2021 06:23:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43587/fix-rewritable-error-of-elgg</link>
	<title><![CDATA[Fix rewritable error of ELGG !]]></title>
	<description><![CDATA[<p>The&nbsp;<code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;module uses a rule-based rewriting engine, based on a PCRE regular-expression parser, to rewrite requested URLs on the fly. By default,&nbsp;<code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;maps a URL to a filesystem path. However, it can also be used to redirect one URL to another URL, or to invoke an internal proxy fetch.</p>
<p><code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;provides a flexible and powerful way to manipulate URLs using an unlimited number of rules. Each rule can have an unlimited number of attached rule conditions, to allow you to rewrite URL based on server variables, environment variables, HTTP headers, or time stamps.</p>
<p><code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;operates on the full URL path, including the path-info section. A rewrite rule can be invoked in&nbsp;<code>httpd.conf</code>&nbsp;or in&nbsp;<code>.htaccess</code>. The path generated by a rewrite rule can include a query string, or can lead to internal sub-processing, external request redirection, or internal proxy throughput.</p>
<p>Further details, discussion, and examples, are provided in the&nbsp;<a href="https://httpd.apache.org/docs/2.4/rewrite/">detailed mod_rewrite documentation</a>.</p>
<p>&nbsp;</p>
<ul>
<li>sudo a2enmod rewrite</li>
</ul>
<ul>
<li>sudo systemctl restart apache2</li>
</ul>
<ul>
<li>sudo nano /etc/apache2/sites-available/000-default.conf</li>
</ul>
<p>Write this</p>
<div title="/etc/apache2/sites-available/000-default.conf">/etc/apache2/sites-available/000-default.conf</div>
<div>
<div>
<pre><code><span>&lt;</span>VirtualHost *:8<span><span>0</span>&gt;</span>
    <span></span><span><span>&lt;</span>Directory /var/www/html<span>&gt;</span></span><span></span>
        <span>Options Indexes FollowSymLinks MultiViews</span>
        <span>AllowOverride All</span>
        <span>Require all granted</span>
    <span></span><span><span>&lt;</span>/Directory<span>&gt;</span></span><span></span>

    <span>.</span> <span>.</span> <span>.</span>
<span>&lt;</span>/VirtualHost<span>&gt;</span></code></pre>
</div>
</div><p>Address of the bookmark: <a href="https://www.digitalocean.com/community/tutorials/how-to-rewrite-urls-with-mod_rewrite-for-apache-on-ubuntu-18-04" rel="nofollow">https://www.digitalocean.com/community/tutorials/how-to-rewrite-urls-with-mod_rewrite-for-apache-on-ubuntu-18-04</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44403/programming-for-lovers</guid>
	<pubDate>Tue, 07 Nov 2023 23:56:30 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44403/programming-for-lovers</link>
	<title><![CDATA[Programming for Lovers !]]></title>
	<description><![CDATA[<p>Programming for Lovers (P4❤️) is a free online course that teaches programming using the Go programming language by immersing learners in fun scientific applications.</p>
<p>Each chapter focuses on a single scientific problem and contains a core text accompanied by code alongs and autograded exercises.</p>
<p>You can meet Phillip Compeau in our intro video. Phillip has taught programming at Carnegie Mellon University for years and is a serial online education founder. He is thrilled to bring you this course.</p><p>Address of the bookmark: <a href="https://programmingforlovers.com/" rel="nofollow">https://programmingforlovers.com/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43042/bioinformatics-in-thailand</guid>
	<pubDate>Wed, 28 Apr 2021 02:04:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43042/bioinformatics-in-thailand</link>
	<title><![CDATA[Bioinformatics in Thailand !]]></title>
	<description><![CDATA[<p>Our international PhD and master programs are designed for students who desire focused training in the elements of biology, computer science, and information technology needed for a successful career in the exciting new discipline of Bioinformatics &amp; Systems Biology. Students in our program will receive comprehensive training in omics analysis, database design and management, software engineering and programming (including web-based development), simulation techniques and modeling, and data integration. Each student will apply their skills to a practical project, where they will design and implement a solution to a real-world problem under the guidance of an experienced mentor in industry or academia.</p>
<p><strong>https://bioinformatics.kmutt.ac.th/about.html</strong></p>
<p>Duangrudee Tanramluk (Ajarn Wi) uses computational biology and machine learning to tackle the key to drug design problems via MANORAA webserver.</p>
<p><strong>https://mb.mahidol.ac.th/en/bioinformatics/</strong></p>
<p><strong>https://graduate.mahidol.ac.th/inter/</strong></p>
<p>This&nbsp;international&nbsp;Doctorate programme is designed to further broaden students&rsquo; knowledge in Bioinformatics and Molecular Biology to their maximum capability.&nbsp;</p>
<p><strong>http://www.mbb.psu.ac.th/programmes/phd</strong></p>
<p>Ph.D. program in Bioinformatics and Computational Biology is a joint effort of the Faculty of Science and Faculty of Medicine, Chulalongkorn University. The program has study plans for both applicants who hold a bachelor&rsquo;s degree and applicants who hold a master&rsquo;s degree in any related fields of study.</p>
<p><strong>http://www.bioinfo.sc.chula.ac.th/ph-d-program-specialization/</strong></p>
<p>Additional detail&nbsp;</p>
<p><strong>https://www.biotec.or.th/en/index.php/research/research-units/genome-technology-research-unit</strong></p>
<p><strong>https://tbrcnetwork.org/labtbrc/index.php/bioinformatics-and-chemoinformatics/</strong></p>
<p><strong>https://genomicsthailand.com/Genomic/home</strong></p><p>Address of the bookmark: <a href="https://bioinformatics.kmutt.ac.th/" rel="nofollow">https://bioinformatics.kmutt.ac.th/</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43631/pangolin-tutorial</guid>
	<pubDate>Fri, 10 Dec 2021 05:58:59 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43631/pangolin-tutorial</link>
	<title><![CDATA[Pangolin tutorial !]]></title>
	<description><![CDATA[<p><span>This is a tutorial for using the Pangolin Web Application. For information on using the command line tool, please visit the&nbsp;</span><a href="https://cov-lineages.org/resources/pangolin/usage.html">command line tool usage page</a><span>.</span></p>
<p>https://cov-lineages.org/resources/pangolin/tutorial.html</p><p>Address of the bookmark: <a href="https://cov-lineages.org/resources/pangolin/tutorial.html" rel="nofollow">https://cov-lineages.org/resources/pangolin/tutorial.html</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44601/free-resources-to-learn-statistics</guid>
	<pubDate>Sat, 06 Jul 2024 10:30:50 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44601/free-resources-to-learn-statistics</link>
	<title><![CDATA[Free resources to learn statistics]]></title>
	<description><![CDATA[<p><span>Welcome to the course notes for&nbsp;</span><span>STAT 414: Introduction to Probability Theory</span><span>. These notes are designed and developed by Penn State's&nbsp;</span><a href="https://science.psu.edu/stat">Department of Statistics</a><span>&nbsp;and offered as open educational resources. These notes are free to use under Creative Commons license&nbsp;</span><a href="https://creativecommons.org/licenses/by-nc/4.0/">CC BY-NC 4.0</a><span>.</span></p>
<p>&nbsp;</p>
<p>A free online version of the second edition of the book based on Stat 110,&nbsp;<em>Introduction to Probability</em>&nbsp;by Joe Blitzstein and Jessica Hwang,&nbsp;is now available at&nbsp;<a href="http://probabilitybook.net/" title="http://probabilitybook.net">http://probabilitybook.net</a></p>
<p>Print copies are available via&nbsp;<a href="https://www.crcpress.com/Introduction-to-Probability-Second-Edition/Blitzstein-Hwang/p/book/9781138369917" title="">CRC Press</a>,&nbsp;<a href="https://amzn.to/2Ubh7D8" title="">Amazon</a>, and elsewhere.&nbsp;</p>
<p>Stat110x is also available as an&nbsp;edX course.&nbsp;Free signup at&nbsp;<a href="https://www.edx.org/course/introduction-to-probability-0" title="https://www.edx.org/course/introduction-to-probability-0">https://www.edx.org/course/introduction-to-probability-0</a></p>
<p>The edX course focuses on animations, interactive features, readings, and problem-solving, and&nbsp;is&nbsp;<strong>complementary</strong>&nbsp;to the Stat 110 lecture videos on YouTube, which are available at&nbsp;<a href="https://goo.gl/i7njSb" title="https://goo.gl/i7njSb">https://goo.gl/i7njSb</a></p>
<p>The Stat110x animations are available within the course and at&nbsp;<a href="https://goo.gl/g7pqTo" title="">https://goo.gl/g7pqTo</a></p>
<p><a href="https://projects.iq.harvard.edu/stat110/home">https://projects.iq.harvard.edu/stat110/home</a>&nbsp;</p><p>Address of the bookmark: <a href="https://online.stat.psu.edu/stat414/" rel="nofollow">https://online.stat.psu.edu/stat414/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30336/finding-patterns-in-biological-sequences</guid>
	<pubDate>Thu, 22 Dec 2016 10:30:49 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30336/finding-patterns-in-biological-sequences</link>
	<title><![CDATA[Finding Patterns in Biological Sequences]]></title>
	<description><![CDATA[<p>In this report we provide an overview of known techniques for discovery of patterns of biological sequences (DNA and proteins). We also provide biological motivation, and methods of biological verification of such patterns. Finally we list publicly available tools and databases for pattern discovery. On-line supplement is available through http://genetics.uwaterloo.ca/&sim;tvinar/cs798g/motif.</p><p>Address of the bookmark: <a href="http://engr.case.edu/li_jing/papers/00798gpattern.pdf" rel="nofollow">http://engr.case.edu/li_jing/papers/00798gpattern.pdf</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44362/biostats-book</guid>
	<pubDate>Mon, 14 Aug 2023 03:11:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44362/biostats-book</link>
	<title><![CDATA[Biostats book !]]></title>
	<description><![CDATA[<p>https://practical-stats-med-r.netlify.app/</p><p>Address of the bookmark: <a href="https://practical-stats-med-r.netlify.app/" rel="nofollow">https://practical-stats-med-r.netlify.app/</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/2882/phylogenetics</guid>
	<pubDate>Fri, 23 Aug 2013 03:53:43 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/2882/phylogenetics</link>
	<title><![CDATA[Phylogenetics]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/fQwI90bkJl4" frameborder="0" allowfullscreen></iframe>006 - Phylogenetics

Paul Andersen discusses the specifics of phylogenetics.  The evolutionary relationships of organisms are discovered through both morphological and molecular data.  A specific type of phylogenetic tree, the cladogram, is also covered.

Intro Music Atribution
Title: I4dsong_loop_main.wav
Artist: CosmicD
Link to sound: http://www.freesound.org/people/CosmicD/sounds/72556/
Creative Commons Atribution License]]></description>
	
</item>

</channel>
</rss>