<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44616?offset=200</link>
	<atom:link href="https://bioinformaticsonline.com/related/44616?offset=200" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44882/fantasia</guid>
	<pubDate>Wed, 20 Aug 2025 02:48:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44882/fantasia</link>
	<title><![CDATA[FANTASIA]]></title>
	<description><![CDATA[<p dir="auto">FANTASIA is an advanced pipeline for the automatic functional annotation of protein sequences using state-of-the-art protein language models. It integrates deep learning embeddings and in-memory similarity searches, retrieving reference vectors from a PostgreSQL database with pgvector, to associate Gene Ontology (GO) terms with proteins.</p>
<p>https://www.nature.com/articles/s42003-025-08651-2</p><p>Address of the bookmark: <a href="https://github.com/CBBIO/FANTASIA" rel="nofollow">https://github.com/CBBIO/FANTASIA</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/4873/vveks-lab</guid>
  <pubDate>Thu, 26 Sep 2013 11:11:39 -0500</pubDate>
  <link></link>
  <title><![CDATA[Vvek's Lab]]></title>
  <description><![CDATA[
<p>Broad Area of Research: RNA biology (microRNA, lncRNA), Stem cells, Functional genomics, Epigenomics and Cancer</p>

<p>RNAs, especially non-coding RNAs (such as microRNA, long ncRNAs) are recently identified to be very abundant in mammalian organisms and play some key roles in gene expression regulation, gene silencing, and also implicated in disease progression, stem cell pluripotency etc. Current research activities of our lab include analysis of expression pattern of ncRNAs by microarray and next-gen sequencing data and understanding the role of miRNAs or other regulatory RNAs in various diseases, especially cancer and validation by reporter assays (renilla/luciferase) and other experimental tools.</p>

<p>More @ http://vvekslab.in/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/17843/pathway-analysis</guid>
	<pubDate>Fri, 03 Oct 2014 08:51:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/17843/pathway-analysis</link>
	<title><![CDATA[Pathway Analysis]]></title>
	<description><![CDATA[<p>Pathway Analysis is usually performed with aim to enrich the genes with their functional information and reveal the underlying biological mechanisms pursue by genes. Pathway Analysis is not only limited to what biological pathways a particular set of expressed genes follow but also to disclose the relationships between these genes. With availability of more genomics, transcriptomics and proteomics data, interactions between genes involve in multiple pathways become more clear and also relationships between the genes, their transcripts, and their gene products. However, existing tools and dbs mainly based on knowledge driven approach in which pathways will be identified by finding the correlation between the&nbsp;<span>information in one of the pathway knowledge databases (KEGG,Reactome,Panther,BioCarta, Panther,GO,NCI,WikiPathways,etc) and gene expression result for a specific conditions for instance tumor, obesity , cold resistant crops/plants, etc.</span></p><p><span><strong>Introductory Articles/ppt/sources</strong>:</span></p><p><a href="http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1002375"><span>http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1002375</span></a></p><p><a href="http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf"><span>http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf</span></a></p><p><a href="http://gettinggeneticsdone.blogspot.de/2012/03/pathway-analysis-for-high-throughput.html"><span>http://gettinggeneticsdone.blogspot.de/2012/03/pathway-analysis-for-high-throughput.html</span></a></p><p><a href="http://davetang.org/muse/tag/pathway/"><span>http://davetang.org/muse/tag/pathway/</span></a></p><p><a href="https://www.biostars.org/p/42219/"><span>https://www.biostars.org/p/42219/</span></a></p><p><a href="http://bioinformatics.ca//files/public/Pathways_2014_Module4_v2.pdf"><span>http://bioinformatics.ca//files/public/Pathways_2014_Module4_v2.pdf</span></a></p><p><a href="http://bioinformatics.ca//files/public/Pathways_2014_Module2.pdf"><span>http://bioinformatics.ca//files/public/Pathways_2014_Module2.pdf</span></a></p><p><span><strong>Impotant Database and Tools</strong>:</span></p><p>GeneMANIA, Cytoscape,&nbsp;<a href="http://www.ingenuity.com/products/ipa">IPA</a>&nbsp;and <a href="http://thomsonreuters.com/metacore/">Metacore</a> (Commerical ),&nbsp;<span>Pathway Commons, Reactome ,Panther, BioCyc, WikiPathways, Pathvisio, KEGG, NCI, Stringdb, Amigo,&nbsp;<span>WebGestalt ,<span>ConsensusPathDB ,GSEA,Blast2go</span></span></span></p><p><span><strong>Popular R based tools</strong>:</span></p><p><span>Reactome.db, ReactomePA, ClusterProfiler, Gage, SPIA, topGO, Pathview,DOSE,GOStat</span></p><p><span><strong>More</strong>:</span></p><p><a href="http://www.bioconductor.org/help/search/index.html?q=Enrichment+analysis+"><span>http://www.bioconductor.org/help/search/index.html?q=Enrichment+analysis+</span></a></p><p>&nbsp;</p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/29004/r-chie</guid>
	<pubDate>Thu, 01 Sep 2016 11:47:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/29004/r-chie</link>
	<title><![CDATA[R-chie]]></title>
	<description><![CDATA[<p><strong>R-chie</strong><span>&nbsp;allows you to make arc diagrams of RNA secondary structures, allowing for easy comparison and overlap of two structures, rank and display basepairs in colour and to also visualize corresponding multiple sequence alignments and co-variation information.</span><br><strong>R4RNA</strong><span>&nbsp;is the R package powering R-chie, available for&nbsp;</span><a href="http://www.e-rna.org/r-chie/download.cgi">download</a><span>&nbsp;and local use for more customized figures and scripting.</span></p>
<p>http://www.e-rna.org/r-chie/plot.cgi?eg=single</p><p>Address of the bookmark: <a href="http://www.e-rna.org/r-chie/plot.cgi?eg=single" rel="nofollow">http://www.e-rna.org/r-chie/plot.cgi?eg=single</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Fri, 07 Sep 2018 05:19:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[<p><span>P_RNA_scaffolder is a novel scaffolding tool using Pair-end RNA-seq to scaffold genome fragments. The method is suitable for most genomes. The program could utilize Illumina Paired-end RNA-sequencing reads from target speciesies. Our method provides another practical alternative to existing mate-pair_based approaches or other Protein-based approaches (for instance,&nbsp;</span><a href="http://www.fishbrowser.org/software/PEP_scaffolder/">PEP_scaffolder&nbsp;</a><span>) for scaffolding genome sequences. The most important feature of this method is to improve the completeness of gene regions and long-coding gene regions (for instance,&nbsp;</span><a href="http://circrna.org/">circRNA</a><span>).</span></p><p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/#" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/#</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41881/hdock-server</guid>
	<pubDate>Tue, 16 Jun 2020 01:54:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41881/hdock-server</link>
	<title><![CDATA[HDOCK SERVER]]></title>
	<description><![CDATA[<p>HDOCK SERVER</p>
<p>Protein-protein and protein-DNA/RNA docking based on a hybrid algorithm of template-based modeling and&nbsp;<em>ab initio</em>&nbsp;free docking.</p>
<p><span>The HDOCK server distinguishes itself from similar docking servers in its ability to support amino acid sequences as input and a hybrid docking strategy in which experimental information about the protein&ndash;protein binding site and small-angle X-ray scattering can be incorporated during the docking and post-docking processes.</span></p><p>Address of the bookmark: <a href="http://hdock.phys.hust.edu.cn/" rel="nofollow">http://hdock.phys.hust.edu.cn/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44626/meta-transcriptomics-dynamic-world-of-rna-in-diverse-environments</guid>
	<pubDate>Wed, 31 Jul 2024 02:40:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44626/meta-transcriptomics-dynamic-world-of-rna-in-diverse-environments</link>
	<title><![CDATA[Meta-Transcriptomics: Dynamic World of RNA in Diverse Environments]]></title>
	<description><![CDATA[<p>Meta-transcriptomics combines high-throughput sequencing technologies with computational biology to profile the RNA content of a sample. This technique allows researchers to capture a snapshot of gene expression and metabolic activities across diverse microbial communities, such as those found in soil, water, and the human gut.</p><p><strong>Key Components</strong></p><ol>
<li>
<p><strong>Sample Collection</strong>: Meta-transcriptomics begins with the collection of environmental samples. These samples are often complex, containing a wide range of microorganisms.</p>
</li>
<li>
<p><strong>RNA Extraction</strong>: RNA is extracted from the sample, which includes mRNA, rRNA, tRNA, and other non-coding RNAs. This step is crucial as it determines the quality and representativeness of the data.</p>
</li>
<li>
<p><strong>Sequencing</strong>: High-throughput RNA sequencing (RNA-seq) technologies are used to obtain sequences of the RNA transcripts. This step provides a vast amount of data on the RNA molecules present in the sample.</p>
</li>
<li>
<p><strong>Data Analysis</strong>: Computational tools and bioinformatics methods are employed to process and analyze the sequencing data. This involves mapping RNA sequences to reference genomes or transcriptomes, identifying expressed genes, and quantifying their abundance.</p>
</li>
<li>
<p><strong>Functional Annotation</strong>: The functional roles of identified transcripts are inferred based on known gene functions, allowing researchers to understand the metabolic and ecological functions of the microbial community.</p>
</li>
</ol><p><strong>Applications</strong></p><ol>
<li>
<p><strong>Environmental Monitoring</strong>: Meta-transcriptomics can be used to monitor the health and functional status of ecosystems. For example, it can help assess the impact of pollution on microbial communities by revealing changes in gene expression related to stress response and degradation processes.</p>
</li>
<li>
<p><strong>Microbiome Research</strong>: In human health, meta-transcriptomics offers insights into the gut microbiome&rsquo;s functional state. It helps in understanding how microbial communities interact with their host, how they respond to dietary changes, and their role in health and disease.</p>
</li>
<li>
<p><strong>Biotechnology</strong>: The technique can aid in the discovery of novel enzymes and bioactive compounds by profiling microbial communities in extreme environments or industrial processes.</p>
</li>
<li>
<p><strong>Disease Pathogenesis</strong>: By analyzing RNA profiles from disease-associated environments, researchers can uncover pathogen-host interactions and identify potential targets for therapeutic interventions.</p>
</li>
</ol><p><strong>Challenges</strong></p><ol>
<li>
<p><strong>Complexity of Data</strong>: The sheer volume and complexity of data generated by meta-transcriptomics can be overwhelming. Effective data management and advanced computational tools are required to extract meaningful insights.</p>
</li>
<li>
<p><strong>Sampling Bias</strong>: Environmental samples can be heterogeneous, and RNA extraction methods may introduce biases, potentially affecting the accuracy of the results.</p>
</li>
<li>
<p><strong>Reference Databases</strong>: Incomplete or biased reference databases can hinder the accurate functional annotation of transcripts, especially when studying novel or poorly characterized organisms.</p>
</li>
</ol><p><strong>Future Directions</strong></p><p>Meta-transcriptomics is a rapidly evolving field, with ongoing advancements in sequencing technologies and bioinformatics. Future research may focus on improving data integration, developing more comprehensive reference databases, and enhancing our understanding of microbial community dynamics in various environments. As these challenges are addressed, meta-transcriptomics will continue to provide valuable insights into the functional roles of microorganisms and their interactions within ecosystems.</p><p><strong>Conclusion</strong></p><p>Meta-transcriptomics represents a powerful tool for exploring the functional aspects of microbial communities in their natural environments. By capturing a snapshot of gene expression and metabolic activities, this approach offers a deeper understanding of ecological interactions, health implications, and biotechnological potentials. As technology and methodologies advance, meta-transcriptomics is poised to make significant contributions to our knowledge of the microbial world.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11735/search-shell-command-history</guid>
	<pubDate>Thu, 12 Jun 2014 17:43:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11735/search-shell-command-history</link>
	<title><![CDATA[Search Shell Command History]]></title>
	<description><![CDATA[<p>We use couple of hundreads of command in daily basis. Most of them are actually repeated several time. The question remain open how do I search old command history under bash shell and modify or reuse it? <br /><br />Now a days almost all modern shell allows you to search command history if enabled by user. Use history command to display the history list with line numbers. Lines listed with with a * have been modified by user.</p><p><br /><strong>Shell history search command</strong><br /><br />Type history at a shell prompt:<br />$ history</p><p>It will display the list of all used commandline history with an serial number.<br /><br />To search particular command, enter:<br />$ history | grep command-name<br />$ history | egrep -i 'scp|ssh|ftp'<br />Emacs Line-Edit Mode Command History Searching<br /><br />To get previous command containing string, hit [CTRL]+[r] followed by search string:<br /><br />(reverse-i-search): <br /><br />To get previous command, hit [CTRL]+[p]. You can also use up arrow key.<br /><br />CTRL-p<br /><br />To get next command, hit [CTRL]+[n]. You can also use down arrow key.<br /><br />CTRL-n<br /><br /></p><p><strong>fc command</strong></p><p>Apart from hostory command there are fc command to extract the command from history. The fc stands for either "find command" or "fix command.</p><p>For example list last 10 command, enter:<br />$ fc -l 10<br />To list commands 130 through 150, enter:<br />$ fc -l 130 150<br />To list all commands since the last command beginning with ssh, enter:<br />$ fc -l ssh<br />You can edit commands 1 through 5 using vi text editor, enter:<br />$ fc -e vi 1 5</p><p><strong>Delete command history</strong><br /><br />The -c option causes the history list to be cleared by deleting all of the entries:<br />$ history -c</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42645/mmseqs2-ultra-fast-and-sensitive-sequence-search-and-clustering-suite</guid>
	<pubDate>Mon, 18 Jan 2021 10:47:56 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42645/mmseqs2-ultra-fast-and-sensitive-sequence-search-and-clustering-suite</link>
	<title><![CDATA[MMseqs2: ultra fast and sensitive sequence search and clustering suite]]></title>
	<description><![CDATA[<p><span>MMseqs2 (Many-against-Many sequence searching) is a software suite to search and cluster huge protein and nucleotide sequence sets. MMseqs2 is open source GPL-licensed software implemented in C++ for Linux, MacOS, and (as beta version, via cygwin) Windows. The software is designed to run on multiple cores and servers and exhibits very good scalability. MMseqs2 can run 10000 times faster than BLAST. At 100 times its speed it achieves almost the same sensitivity. It can perform profile searches with the same sensitivity as PSI-BLAST at over 400 times its speed.</span></p><p>Address of the bookmark: <a href="https://github.com/soedinglab/MMseqs2" rel="nofollow">https://github.com/soedinglab/MMseqs2</a></p>]]></description>
	<dc:creator>Manisha Mishra</dc:creator>
</item>

</channel>
</rss>