Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

2.Mapmygenome™
Royal Demeure,HUDA Techno Enclave,
Plot No. 12/2, Sector-1 500 081 
Madhapur,Hyderabad
AP, India

3. DNA Labs India

http://www.dnalabsindia.com/lab.php

4.MedGenome Labs Pvt Ltd
(Division of SciGenom Labs Pvt Ltd.)
Plot no: 43A,SDF, 3rd floor
A Block,CSEZ, Kakanad, Cochin
Kerala - 682037 
Phone: 0484 - 2413399
Fax: 0484 - 2413398
Email: info@medgenome.com

5.Narayana Nethralaya

Narayana Hrudayalaya Campus
Narayana Health City
# 258/A, Bommasandra, Hosur Road, 
Bangalore - 560 099 - INDIA.
TEL: +91-80-66660655-0658 
FAX: +91-80-66660650 
Mobile: 9902 821128 (Emergency Only)
e-mail: info@narayananethralaya.com

6.BioAxis DNA Research Centre Private Limited
13-51,Sri Lakshmi Nagar colony,
Besides Big Bazar, Near Kamineni Hospitals
GSI Post BandalGuda (L B Nagar) Hydeabad-500068
Andhra Pradesh (India).
Phone : +91-40-24034503/+91-9246338983

7.Gene Guiide

8th Floor, Embassy Towers, 7 Bungalows Rd, Versova, Andheri West, Mumbai-61 
 09167 117799 
 info@geneguiide.com 

See more at: http://www.geneguiide.com

8.INDIAN BIOSCIENCES
Regd. Office:
G-2 (Ground Floor Rear), Kailash Colony, New Delhi - 110048, India.
Phone: +91 (0)11 29236088, Email: info@inbdna.com.

9.SRL Limited

GP-26, MARUTI INDUSTRIAL ESTATE,

UDYOG VIHAR,SECTOR-18,

GURGAON - 122015

Tel: 0124-3001243 / 0124-3001209

SRL Limited
VASANT VIHAR, 8, PALAM MARG,
NEW DELHI - 110057
Tel: 011 - 4229 5333 

Website: http://www.srlworld.com
National Customer care number:
Call Toll Free : 1800-222-660/1800-102-8282 
E-mail id: customercare@srl.in

10.Tata Memorial Centre,

Advanced Centre for Treatment, Research and Education in Cancer

Kharghar, Navi Mumbai - 410 210, INDIA.

Tel: +91-22-2740 5000

Fax: +91-22-2740 5085

E-mail: mail@actrec.gov.in

The biggest and perhaps most fearsome of the world's big cats, the tiger, shares 95.6 percent of its DNA with humans' cute and furry companions, domestic cats.

The new research showed that big cats have genetic mutations that enabled them to be carnivores. The team also identified mutations that allow snow leopards to thrive at high altitudes.

Reference:

http://www.nbcnews.com/science/your-cat-ferocious-tigers-share-lot-95-6-percent-their-4B11182690

http://timesofindia.indiatimes.com/home/environment/flora-fauna/Gene-mapping-of-tiger-completed/articleshow/22671681.cms

Paper:

http://www.nature.com/ncomms/2013/130917/ncomms3433/full/ncomms3433.html

The vital metaphase stage of cell division, when the sister chromatids migrated to the centre and lined up in a row, and pulled apart using attached microtubules in such a way that half the DNA ends up in each daughter cell. However, before the mitotic spindle‐mediated movement gets start and pulled DNA apart, the chromosomes are free to undergo recombination which involves the exchange of genetic material either between multiple chromosomes or between different regions of the same chromosome.

During recombination, the precise breakage of each strand, exchange between the strands, and sealing of the resulting recombined molecules happens. The “chromosomal breakpoints” refers to these places where they break. Mostly, this process occurs with a high degree of accuracy at high frequency in both eukaryotic and prokaryotic cells. But occasionally this “break and sealing/ break and reattach” process goes wrong and the reattachment happens in the wrong place which usually create disaster (with few exceptions).These chromosome disaster or abnormalities involve the gain, loss or rearrangement of visible amounts of genetic material during cell division. These abnormalities are of two type, the first one is numerical abnormalities  where severe disorders are caused by the loss or gain of whole chromosomes, which affect the copy number of hundreds or even thousands of genes. The second are structural abnormalities which can be unbalanced or balanced. The former are similar to numerical abnormalities in that genetic material is either gained or lost. The natural defects in chromosome segregation are linked to cancer and several genetic diseases (http://en.wikipedia.org/wiki/List_of_genetic_disorders). Therefore, the enzymes involved in regulating cell division are still the attractive drug targets for many diseases.

Apart from certain chromosome abnormalities, these “crossing over” of segments of maternal and paternal chromosomes to form hybrid chromosomes have some evolutionary importance and considered as a driver of genetic variation. Moreover, the chromosome breakage in evolution is considered to be non-random in nature(http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.0020014). In addition the study of breakpoint regions and non-breakpoint (stable) regions of chromosomes indicates both the regions evolved in distinctly different ways ( http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2675965/). These breakage may lead to genetic diseases or participate to chromosomal rearranmgnets and contributed in development of new species.

I will try to explain the genome hotspots/Evolutionary Breakpoint Regions(EBRs)/fragile regions/weak fragments/  in my next blog.

Software for recombination detection:

RAT http://cbr.jic.ac.uk/dicks/software/RAT/

Breakpointer https://github.com/ruping/Breakpointer

DRP http://web.cbio.uct.ac.za/~darren/rdp.html

RB-finder http://www.ncbi.nlm.nih.gov/pubmed/18707535

LDhat2.0 http://ldhat.sourceforge.net/LDhat2.0/instructions.shtml

Reference:

http://www.nature.com/scitable/topicpage/genetic-recombination-514#

Image: Wikipedia , sciencelearn.org.nz

Recommended Articles:

http://www.friendshipcircle.org/blog/2012/05/22/13-chromosomal-disorders-youve-never-heard-of/

http://web.udl.es/usuaris/e4650869/docencia/segoncicle/genclin98/recursos_classe_%28pdf%29/revisionsPDF/chromosyndromes.pdf

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2775595/table/T2/

http://learn.genetics.utah.edu/content/disorders/chromosomal/

http://www.ncert.nic.in/html/learning_basket/biology/cc&cd.pdf

EAGER encompasses both state-of-the-art tools for each step as well as new complementary tools tailored for ancient DNA data within a single integrated solution in an easily accessible format.

https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0918-z

Address of the bookmark: https://github.com/apeltzer/EAGER-GUI

Address of the bookmark: https://chunlab.wordpress.com/tetra-nucleotide-analysis/

This also includes:

• A2Amapper: ATAC, Assembly to Assembly Comparision tool:
  • Comparative mapping between two genome assemblies (same species), or between two different genomes (cross species).

• Sim4db:
  • Spliced alignment of cDNA and genomic sequences, from the same (sim4) or related (sim4cc) species. Optimized for high-throughput batched alignment.

• LEAFF:
  • LEAFF (ahem, Let's Extract Anything From Fasta) is a utility program for working with multi-fasta files. In addition to providing random access to the base level, it includes several analysis functions.

• Meryl:
  • An out-of-core k-mer counter. The amount of sequence that can be processed for any size k depends only on the amount of free disk space.

Address of the bookmark: https://help.rc.ufl.edu/doc/Kmer

Address of the bookmark: http://www.seqan.de/apps/stellar/

Address of the bookmark: https://github.com/ParBLiSS/FastANI

Address of the bookmark: https://www.ezbiocloud.net/tools/orthoani