The changes in nr preserve the taxonomic diversity of the entries in the database while reducing the number of titles for identical sequences. GenPept accessions are still accessible via www.ncbi.nlm.nih.gov/protein/$GENBANK_ACCESSION or the IPG website https://www.ncbi.nlm.nih.gov/ipg/.

The "Identical Proteins" link in the alignments section of the webBLAST results takes you to a full list of all accessions associated with a sequence.

For BLAST+ users downloading nr_v5: the database is now approximately 50% smaller, resulting in faster downloads and BLAST searches, and smaller disk space requirements. The database is downloadable at:  ftp://ftp.ncbi.nlm.nih.gov/blast/db/v5/

For BLAST+ there is a cleanup script to help you manage the transition to this smaller database. The script removes unused database volumes: ftp://ftp.ncbi.nlm.nih.gov/blast/temp/cleanup-blastdb-volumes.py

Here are the new rules on how we keep titles in nr_v5:

1.    We keep all refseq, swissprot, pir and PDB titles.

2.    We keep any GenPept titles with a TAXID that has not already been seen in the record.

3.    We keep at least five GenPept titles regardless of whether the TAXIDS have been seen before or not in this record.

If you have any questions or concerns, please contact blast-help@ncbi.nlm.nih.gov

A fairly complete on-line guide to BLAST searching can be found at the NCBI BLAST Help Manual. For a theoretical overview of BLAST, see the NCBI BLAST Course. Additional information can be found in the BLAST 2.0 Release Notes

Supported and Suggested Values for Gap Open and Extension in BLASTP, BLASTX, TBLASTN, and TBLASTX

Address of the bookmark: https://www.arabidopsis.org/Blast/BLASToptions.jsp

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

2.Mapmygenome™
Royal Demeure,HUDA Techno Enclave,
Plot No. 12/2, Sector-1 500 081 
Madhapur,Hyderabad
AP, India

3. DNA Labs India

http://www.dnalabsindia.com/lab.php

4.MedGenome Labs Pvt Ltd
(Division of SciGenom Labs Pvt Ltd.)
Plot no: 43A,SDF, 3rd floor
A Block,CSEZ, Kakanad, Cochin
Kerala - 682037 
Phone: 0484 - 2413399
Fax: 0484 - 2413398
Email: info@medgenome.com

5.Narayana Nethralaya

Narayana Hrudayalaya Campus
Narayana Health City
# 258/A, Bommasandra, Hosur Road, 
Bangalore - 560 099 - INDIA.
TEL: +91-80-66660655-0658 
FAX: +91-80-66660650 
Mobile: 9902 821128 (Emergency Only)
e-mail: info@narayananethralaya.com

6.BioAxis DNA Research Centre Private Limited
13-51,Sri Lakshmi Nagar colony,
Besides Big Bazar, Near Kamineni Hospitals
GSI Post BandalGuda (L B Nagar) Hydeabad-500068
Andhra Pradesh (India).
Phone : +91-40-24034503/+91-9246338983

7.Gene Guiide

8th Floor, Embassy Towers, 7 Bungalows Rd, Versova, Andheri West, Mumbai-61 
 09167 117799 
 info@geneguiide.com 

See more at: http://www.geneguiide.com

8.INDIAN BIOSCIENCES
Regd. Office:
G-2 (Ground Floor Rear), Kailash Colony, New Delhi - 110048, India.
Phone: +91 (0)11 29236088, Email: info@inbdna.com.

9.SRL Limited

GP-26, MARUTI INDUSTRIAL ESTATE,

UDYOG VIHAR,SECTOR-18,

GURGAON - 122015

Tel: 0124-3001243 / 0124-3001209

SRL Limited
VASANT VIHAR, 8, PALAM MARG,
NEW DELHI - 110057
Tel: 011 - 4229 5333 

Website: http://www.srlworld.com
National Customer care number:
Call Toll Free : 1800-222-660/1800-102-8282 
E-mail id: customercare@srl.in

10.Tata Memorial Centre,

Advanced Centre for Treatment, Research and Education in Cancer

Kharghar, Navi Mumbai - 410 210, INDIA.

Tel: +91-22-2740 5000

Fax: +91-22-2740 5085

E-mail: mail@actrec.gov.in

The biggest and perhaps most fearsome of the world's big cats, the tiger, shares 95.6 percent of its DNA with humans' cute and furry companions, domestic cats.

The new research showed that big cats have genetic mutations that enabled them to be carnivores. The team also identified mutations that allow snow leopards to thrive at high altitudes.

Reference:

http://www.nbcnews.com/science/your-cat-ferocious-tigers-share-lot-95-6-percent-their-4B11182690

http://timesofindia.indiatimes.com/home/environment/flora-fauna/Gene-mapping-of-tiger-completed/articleshow/22671681.cms

Paper:

http://www.nature.com/ncomms/2013/130917/ncomms3433/full/ncomms3433.html