<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44620?</link>
	<atom:link href="https://bioinformaticsonline.com/related/44620?" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/29487/shinyheatmap</guid>
	<pubDate>Fri, 21 Oct 2016 05:12:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/29487/shinyheatmap</link>
	<title><![CDATA[Shinyheatmap]]></title>
	<description><![CDATA[<p><span>Background: Transcriptomics, metabolomics, metagenomics, and other various next-generation sequencing (-omics) fields are known for their production of large datasets. Visualizing such big data has posed technical challenges in biology, both in terms of available computational resources as well as programming acumen. Since heatmaps are used to depict high-dimensional numerical data as a colored grid of cells, efficiency and speed have often proven to be critical considerations in the process of successfully converting data into graphics. For example, rendering interactive heatmaps from large input datasets (e.g., 100k+ rows) has been computationally infeasible on both desktop computers and web browsers. In addition to memory requirements, programming skills and knowledge have frequently been barriers-to-entry for creating highly customizable heatmaps. Results: We propose shinyheatmap: an advanced user-friendly heatmap software suite capable of efficiently creating highly customizable static and interactive biological heatmaps in a web browser. shinyheatmap is a low memory footprint program, making it particularly well-suited for the interactive visualization of extremely large datasets that cannot typically be computed in-memory due to size restrictions. Conclusions: shinyheatmap is hosted online as a freely available web server with an intuitive graphical user interface: http://shinyheatmap.com. The methods are implemented in R, and are available as part of the shinyheatmap project at: https://github.com/Bohdan-Khomtchouk/shinyheatmap.</span></p>
<p><span>More at&nbsp;http://biorxiv.org/content/early/2016/09/21/076463&nbsp;</span></p><p>Address of the bookmark: <a href="http://shinyheatmap.com/" rel="nofollow">http://shinyheatmap.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40948/bio7-an-integrated-development-environment-for-ecological-modeling-scientific-image-analysis-and-statistical-analysis</guid>
	<pubDate>Fri, 07 Feb 2020 23:32:24 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40948/bio7-an-integrated-development-environment-for-ecological-modeling-scientific-image-analysis-and-statistical-analysis</link>
	<title><![CDATA[Bio7: an integrated development environment for ecological modeling, scientific image analysis and statistical analysis]]></title>
	<description><![CDATA[<p><span>The application Bio7 is an integrated development environment for ecological modeling, scientific image analysis and statistical analysis. The application itself is based on an RCP-Eclipse-Environment (Rich-Client-Platform) which offers a huge flexibility in configuration and extensibility because of its plug-in structure and the possibility of customization.</span></p>
<p><a href="https://bio7.org/about/">https://bio7.org/about/</a></p><p>Address of the bookmark: <a href="https://bio7.org/home-2/" rel="nofollow">https://bio7.org/home-2/</a></p>]]></description>
	<dc:creator>Nidhi Rajput</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/28200/machine-learning</guid>
	<pubDate>Fri, 01 Jul 2016 12:57:12 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/28200/machine-learning</link>
	<title><![CDATA[Machine Learning !!!]]></title>
	<description><![CDATA[<p>In machine learning, computers apply&nbsp;<strong>statistical learning</strong>&nbsp;techniques to automatically identify patterns in data. These techniques can be used to make highly accurate predictions.</p>
<p><em>Keep scrolling.</em>&nbsp;Using a data set about homes, we will create a machine learning model to distinguish homes in New York from homes in San Francisco.</p><p>Address of the bookmark: <a href="http://www.r2d3.us/visual-intro-to-machine-learning-part-1/" rel="nofollow">http://www.r2d3.us/visual-intro-to-machine-learning-part-1/</a></p>]]></description>
	<dc:creator>Gudiya Pal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42130/shaman-a-user-friendly-website-for-metataxonomic-analysis-from-raw-reads-to-statistical-analysis</guid>
	<pubDate>Mon, 17 Aug 2020 05:21:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42130/shaman-a-user-friendly-website-for-metataxonomic-analysis-from-raw-reads-to-statistical-analysis</link>
	<title><![CDATA[SHAMAN: a user-friendly website for metataxonomic analysis from raw reads to statistical analysis]]></title>
	<description><![CDATA[<p><span>SHAMAN is a shiny application for differential analysis of metagenomic data (16S, 18S, 23S, 28S, ITS and WGS) including bioinformatics treatment of raw reads for targeted metagenomics, statistical analysis and results visualization with a large variety of plots (barplot, boxplot, heatmap, &hellip;).</span><br><span>The bioinformatics treatment is based on Vsearch [</span><a href="http://www.ncbi.nlm.nih.gov/pubmed/27781170">Rognes 2016</a><span>] which showed to be both accurate and fast [</span><a href="http://www.ncbi.nlm.nih.gov/pubmed/26664811">Wescott 2015</a><span>].The statistical analysis is based on DESeq2 R package [</span><a href="http://www.ncbi.nlm.nih.gov/pubmed/20979621">Anders and Huber 2010</a><span>] which robustly identifies the differential abundant features as suggested in [</span><a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3974642/">McMurdie and Holmes 2014</a><span>] and [</span><a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4727335/">Jonsson2016</a><span>]. SHAMAN robustly identifies the differential abundant genera with the Generalized Linear Model implemented in DESeq2 [</span><a href="http://www.ncbi.nlm.nih.gov/pubmed/25516281">Love 2014</a><span>].</span><br><span>SHAMAN is compatible with standard formats for metagenomic analysis (.csv, .tsv, .biom) and figures can be downloaded in several formats. A presentation about SHAMAN is available&nbsp;</span><a href="https://github.com/aghozlane/shaman/blob/master/www/shaman_presentation.pdf">here</a><span>&nbsp;and a poster&nbsp;</span><a href="https://github.com/aghozlane/shaman/blob/master/www/shaman_poster.pdf">here</a><span>.&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03666-4">https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03666-4</a></span></p><p>Address of the bookmark: <a href="https://github.com/aghozlane/shaman" rel="nofollow">https://github.com/aghozlane/shaman</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/13226/you-and-your-friend-have-similar-dna</guid>
	<pubDate>Sun, 27 Jul 2014 20:44:05 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/13226/you-and-your-friend-have-similar-dna</link>
	<title><![CDATA[You and your friend have similar DNA !!!]]></title>
	<description><![CDATA[<p>New research out of Massachusetts claims that people often choose friends that are similar to them in genetics and they are more accurate than you might suppose. A study published on PNAS&nbsp;http://www.pnas.org/content/111/Supplement_3/10796.full found that people are apt to pick friends who are genetically similar to themselves - so much so that friends tend to be as alike at the genetic level as a person's fourth cousin.</p><div style="text-align: center;"><img src="http://i.kinja-img.com/gawker-media/image/upload/s--CwLwHa43--/18fbmlokxcmqcjpg.jpg" alt="image" width="300" height="271" style="border: 0px; border: 0px;"></div><p>Scientists with a long-running Framingham Heart Study looked at 1,932 people (examination of about 1.5 million markers of genetic variations), comparing unrelated friends to unrelated strangers. They found that friends shared about 1% of their genes &mdash; a percentage much higher than those shared with strangers.This new findings made it clear that people have more DNA in common with those who are selected as friends than with strangers in the same population.&nbsp;</p><p>The genes that lined up the most were olfactory genes, which deal with smell. The ones that lined up the least were immune system genes. The researchers weren't sure why that happened :/. Olfactory genes might be a straightforward explanation: People who like the same smells tend to be drawn to similar environments, where they meet others with the same tendencies.</p><p>Reference:</p><p>http://www.pnas.org/content/111/Supplement_3/10796.full</p><p>Image : http://i.kinja-img.com</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/29343/accnet</guid>
	<pubDate>Fri, 07 Oct 2016 05:22:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/29343/accnet</link>
	<title><![CDATA[AccNET]]></title>
	<description><![CDATA[<p><span>AccNET is a Perl application that presents a new way to study the accessory genome of a given set of organisms. Using the proteomes of these organisms, AccNET create a bipartite network compatible with common network analysis platforms. AccNET collects phylogenetic and functional information in a network improving the analysis capability. Networks offer a new perspective of organism organization through elements acquired by horizontal gene transfers and not constricted by hierarchical structures.</span></p>
<p><span>More at&nbsp;https://www.youtube.com/watch?v=vdGuy1GAJrQ</span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/accnet/" rel="nofollow">https://sourceforge.net/projects/accnet/</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/28835/a5-miseq</guid>
	<pubDate>Thu, 18 Aug 2016 04:05:23 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/28835/a5-miseq</link>
	<title><![CDATA[A5-miseq]]></title>
	<description><![CDATA[<p><span><span>_A5-miseq_ is a pipeline for assembling DNA sequence data generated on the Illumina sequencing platform. This README will take you through the steps necessary for running _A5-miseq_. </span></span></p>
<p><span>Point to note:</span></p>
<p><span>There are many situations where A5-miseq is not the right tool for the job. In order to produce accurate results, A5-miseq requires Illumina data with certain characteristics. A5-miseq will likely not work well with Illumina reads shorter than around 80nt, or reads where the base qualities are low in all or most reads before 60nt. A5-miseq assumes it is assembling homozygous haploid genomes. Use a different assembler for metagenomes and heterozygous diploid or polyploid organisms. Use a different assembler if a tool like FastQC reports your data quality is dubious. You have been warned! Datasets consisting solely of unpaired reads are not currently supported.</span></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/ngopt/" rel="nofollow">https://sourceforge.net/projects/ngopt/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/28290/bioinformatics-tools-and-software</guid>
	<pubDate>Tue, 05 Jul 2016 10:02:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/28290/bioinformatics-tools-and-software</link>
	<title><![CDATA[Bioinformatics tools and software]]></title>
	<description><![CDATA[<p><a href="http://drive5.com/usearch">USEARCH &gt;</a><br><span>Extreme high-throughput sequence analysis. Orders of magnitude faster than BLAST.</span>&nbsp;<a href="http://drive5.com/muscle">MUSCLE &gt;</a><br><span>Multiple sequence alignment. Faster and more accurate than CLUSTALW.</span></p>
<p>&nbsp;<a href="http://drive5.com/uparse">UPARSE &gt;</a><br><span>OTU clustering for 16S and other marker genes. Highly accurate OTU sequences and improved diversity measures.</span>&nbsp;<a href="http://drive5.com/uchime">UCHIME &gt;</a><br><span>Chimeric sequence detection.</span>&nbsp;<a href="http://drive5.com/piler">PILER &gt;</a><br><span>De novo genome repeat finder.</span>&nbsp;<a href="http://drive5.com/pilercr">PILER-CR &gt;</a><br><span>Detection of CRISPR repeats in bacterial genomes.</span>&nbsp;<a href="http://drive5.com/qscore">QSCORE &gt;</a><br><span>Compare two multiple alignments for benchmarking.</span>&nbsp;<a href="http://drive5.com/pals">PALS &gt;</a><br><span>Whole-genome alignment.</span>&nbsp;<a href="http://drive5.com/muscle/prefab.htm">PREFAB &gt;</a><br><span>Protein Reference Alignment Database.</span>&nbsp;<a href="http://drive5.com/bench">MSA benchmark collection &gt;</a><br><span>Selected multiple alignment benchmarks in a standardized FASTA format.</span></p><p>Address of the bookmark: <a href="http://drive5.com/software.html" rel="nofollow">http://drive5.com/software.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/28554/megan6</guid>
	<pubDate>Mon, 25 Jul 2016 05:45:22 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/28554/megan6</link>
	<title><![CDATA[MEGAN6]]></title>
	<description><![CDATA[<p>Microbiome analysis using a single application</p>
<p>MEGAN6 is a comprehensive toolbox for interactively analyzing microbiome data. All the interactive tools you need in one application.</p>
<ul>
<li>Taxonomic analysis using the NCBI taxonomy or a customized taxonomy such as SILVA</li>
<li>Functional analysis using InterPro2GO, SEED, eggNOG or KEGG</li>
<li>Bar charts, word clouds, Voronoi tree maps and many other charts</li>
<li>PCoA, clustering and networks</li>
<li>Supports metadata</li>
<li>MEGAN parses many different types of input</li>
</ul>
<p>Why use MEGAN6?</p>
<div>&nbsp;The software is:</div>
<div><ol>
<li>Easy to use. MEGAN6 is a single application and all features are available through menus, toolbars and graphics. No scripting skills required.</li>
<li>Powerful. MEGAN6 allows you to work with hundreds of samples containing&nbsp;hundreds of millions of sequencing reads. Blast-like analysis can be performed using DIAMOND.</li>
<li>Comprehensive. MEGAN6 offers a large range of analysis tools, and is under active development.</li>
</ol></div><p>Address of the bookmark: <a href="https://ab.inf.uni-tuebingen.de/software/megan6" rel="nofollow">https://ab.inf.uni-tuebingen.de/software/megan6</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>