*16S ribosomal RNA (Bacteria and Archaea)

               *18S ribosomal RNA sequences (SSU) from Fungi type and reference material     

               *28S ribosomal RNA sequences (LSU) from Fungi type and reference material

               *Internal transcribed spacer region (ITS) from Fungi type and reference material

You can also download these from the BLAST db FTP area.  See the NCBI Insights post for more detail.

Useful links

-----------------

BLAST form with rRNA/ITS databases

BLAST db download

Targeted loci

If you have any questions or concerns, please contact blast-help@ncbi.nlm.nih.gov

Why Normalize RNA-Seq Data?

Normalization is a crucial step in RNA-Seq analysis for the following reasons:

• Sequencing depth: Different RNA-Seq experiments produce varying numbers of reads, making direct comparisons between samples misleading.

• Gene length: Longer genes inherently generate more reads, irrespective of their actual expression level.

• Bias reduction: Normalization mitigates technical biases, enabling meaningful biological interpretation.

TPM (Transcripts Per Million)

TPM measures the proportion of reads mapped to a transcript, normalized by transcript length and sequencing depth. It is calculated as:

Key Features:

1. Proportionality: TPM values sum to 1,000,000 across all transcripts in a sample, making it easier to compare between samples.

2. Intuitive interpretation: TPM values directly represent the abundance of transcripts in a sample.

3. Preferred for comparisons: TPM facilitates between-sample comparisons better than FPKM.

FPKM (Fragments Per Kilobase Million)

FPKM normalizes read counts by transcript length and sequencing depth, but without enforcing proportionality like TPM. It is defined as:

Key Features:

1. Historical significance: FPKM was one of the first normalization methods used for RNA-Seq.

2. Single-end vs. paired-end: In paired-end sequencing, FPKM becomes RPKM (Reads Per Kilobase Million).

3. Limited utility: FPKM values are not as robust as TPM for cross-sample comparisons due to lack of proportionality.

CPM (Counts Per Million)

CPM normalizes raw read counts by sequencing depth, without considering gene length. It is expressed as:

Key Features:

1. Simplicity: CPM is straightforward and computationally less intensive.

2. Application: Suitable for non-length-dependent analyses, such as comparing total expression levels or differential expression analysis.

3. Gene length agnostic: CPM does not correct for gene length, making it less ideal for measuring expression levels.

When to Use Each Method

• TPM: Best for comparing expression levels between samples, especially when transcript length and sequencing depth vary.

• FPKM: Useful for historical consistency but generally replaced by TPM.

• CPM: Ideal for differential expression analysis when gene length normalization is unnecessary.

Conclusion

Choosing the right normalization method depends on the specific objectives of your RNA-Seq analysis. TPM’s proportionality and robustness make it the preferred choice for most applications, while CPM serves well for differential expression studies. Although FPKM paved the way for RNA-Seq normalization, it has largely been supplanted by TPM in modern workflows. Understanding these methods and their nuances ensures accurate and meaningful interpretations of RNA-Seq data.

References:

1. Li, B., & Dewey, C. N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics.

2. Trapnell, C., et al. (2010). Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature Biotechnology.

3. Law, C. W., et al. (2014). voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biology.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Careful encoding of graph entities allows odgi to efficiently compute and transform pangenomes with minimal overheads. odgi implements a dynamic data structure that leveraged multi-core CPUs and can be updated on the fly.

The edges and path steps are recorded as deltas between the current node id and the target node id, where the node id corresponds to the rank in the global array of nodes. Graphs built from biological data sets tend to have local partial order and, when sorted, the deltas be small. This allows them to be compressed with a variable length integer representation, resulting in a small in-memory footprint at the cost of packing and unpacking.

The RAM and computational savings are substantial. In partially ordered regions of the graph, most deltas will require only a single byte.

Address of the bookmark: https://github.com/pangenome/odgi

Address of the bookmark: http://www.genengnews.com/keywordsandtools/print/3/32115/

Address of the bookmark: http://schizophreniaforum.org/new/detail.asp?id=1953

Introductory Articles/ppt/sources:

http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1002375

http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf

http://gettinggeneticsdone.blogspot.de/2012/03/pathway-analysis-for-high-throughput.html

http://davetang.org/muse/tag/pathway/

https://www.biostars.org/p/42219/

http://bioinformatics.ca//files/public/Pathways_2014_Module4_v2.pdf

http://bioinformatics.ca//files/public/Pathways_2014_Module2.pdf

Impotant Database and Tools:

GeneMANIA, Cytoscape, IPA and Metacore (Commerical ), Pathway Commons, Reactome ,Panther, BioCyc, WikiPathways, Pathvisio, KEGG, NCI, Stringdb, Amigo, WebGestalt ,ConsensusPathDB ,GSEA,Blast2go

Popular R based tools:

Reactome.db, ReactomePA, ClusterProfiler, Gage, SPIA, topGO, Pathview,DOSE,GOStat

More:

http://www.bioconductor.org/help/search/index.html?q=Enrichment+analysis+

https://www.pmgenomics.ca/hoffmanlab/

It takes FASTA DNA sequence as input, and write GFF3 as output. It uses the new NHMMER tool that comes with HMMER 3.1 for HMM searching in RNA:DNA style. NHMMER binaries for 64-bit Linux and Mac OS X are included and will be auto-detected. Multithreading is supported and one can expect roughly linear speed-ups with more CPUs. 

Address of the bookmark: https://github.com/tseemann/barrnap