<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44633?offset=70</link>
	<atom:link href="https://bioinformaticsonline.com/related/44633?offset=70" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44614/online-resources-on-must-read-papers-in-evolutionary-biology</guid>
	<pubDate>Fri, 26 Jul 2024 01:39:14 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44614/online-resources-on-must-read-papers-in-evolutionary-biology</link>
	<title><![CDATA[Online resources on must-read papers in evolutionary biology]]></title>
	<description><![CDATA[<pre>Online resources on must-read papers in evolutionary biology, for a literature club.<br /><br />Below is a summary of all answers that we received.

All the best,

Jana and Xiaoyan

1.       *Nick Barton:*

- The textbook "Evolution" by Nick Barton, with resources for
  exploring the literature: Barton, N. H., Briggs, D. E. G., Eisen, J.
  A., Goldstein, D. B., &amp; Patel, N. H. (2007). Evolution. Cold Spring
  Harbor Laboratory Press.

- Papers from a course named "Classics in Evolutionary Biology":

Evolutionary Synthesis
1. Haldane, J. B. S. 1932. The causes of evolution. Longmans. New York.
   (esp. Ch. IV).
2. Fisher, R. A. 1930. The genetical theory of natural selection. Oxford
   University Press, Oxford. Selected Sections - Fundamental Theorem.

Genetic Variation
1a. Lewontin, R. C., and J. L. Hubby. 1966. A molecular approach to
the study of genic heterozygosity in natural populations. II. Amount
of variation and degree of heterozygosity in natural populations of
Drosophila pseudoobscura. Genetics. 54:595-609.

1b. Sachidandam et al. 2001. A map of human genome sequence variation
containing 1.42 million single nucleotide polymorphisms. 409: 928-33.

2. Wright S., Dobzhansky T., Hovanitz W. 1942 Genetics of natural
populations VII The allelism of lethals in the third chromosome of
Drosophila pseudoobscura. Genetics 27: 363-394.

Recombination and evolution
1. Hill, W. G., and A. Robertson. 1966. The effect of linkage on limits
to artificial selection. Genet. Res. 8:269-294.

2. Maynard Smith and Haigh. 1974. The hitch-hiking effect of a favourable
gene. Genet. Res. 23: 23-35.

Understanding sequence variation
1. Begun D. J., Aquadro C. F., 1992 Levels of naturally occurring DNA
polymorphism correlate with recombination rate in Drosophila melanogaster.
Nature 356: 519-520.

2. Green R. E., Reich D., P&auml;&auml;bo S., 2010 A draft sequence of the
Neandertal genome. Science 328: 710-722.

Quantitative Genetics:  variation in complex traits
1. Galton F., 1877 Typical laws of heredity. Nature 15: 492-495-
512-514- 532-533.

2. Turelli M., 1984 Heritable genetic variation via
mutation-selection balance: Lerch's Zeta meets the abdominal
bristle. Theor. Popul. Biol. 25: 138-193.

Quantitative Genetics:  finding the genes
1. Shrimpton A. E., Robertson A., 1988 The Isolation of polygenic factors
controlling bristle score in Drosophila melanogaster II Distribution of
third chromosome bristle effects within chromosome sections. Genetics
118: 445-459.

2. Boyle E. A., Li Y. I., Pritchard J. K., 2017 An expanded view of
complex traits: from polygenic to omnigenic. Cell 169: 1177-1186.

Neutral Evolution
1. Kimura, M. 1968. Evolutionary rate at the molecular level. Science.
217:624-626.

2a. Kern A. D., Hahn M. W., 2018 The Neutral Theory in Light of Natural
Selection. Molecular Biology and Evolution 110: 21077-6.

2b. Jensen J. D., Payseur B. A., Stephan W., Aquadro C. F., Lynch M.,
Charlesworth D., Charlesworth B., 2018 The importance of the Neutral Theory
in 1968 and 50 years on: a response to Kern and Hahn 2018. Evolution 112:
2109-4.

2c. Ellegren &amp; Galtier. 2016. Determinants of genetic diversity. Nature
Reviews Genetics.

Mutation and Genetic Variability
1. Luria, S. E., and M. Delbr&uuml;ck. 1943. Mutations of Bacteria from Virus
Sensitivity to Virus Resistance. Genetics. 28(6):491-511.

2. Hill, W G. 1982. "Rates of Change in Quantitative Traits From Fixation
of New Mutations." Proceedings of the National Academy of Sciences (U.S.A.)
79: 142-45.

Testing for selection
1. McDonald &amp; Kreitman. 1991. Adaptive protein evolution at the Adh locus
in Drosophila. Nature.

2. Begun, et al. Mol. Biol. Evol. 16, 1816-1819 (1999).

3. Siddiq et al. 2016. Experimental test and refutation of a classic case
of molecular adaptation in Drosophila melanogaster.  Nature Ecology &amp;
Evolution.

The shifting balance
1. Wright, S. 1932. The roles of mutation, inbreeding, crossbreeding and
selection in evolution. Proceedings of the VI International Congress of
Genetics: 1. pp 356-366.

2. Coyne, J.A., N.H. Barton, and M. Turelli. 1997. A critique of Wright's
shifting balance theory of evolution.  Evolution 51: 643-671.

3. Barton. 2016. Sewall Wright on Evolution in Mendelian Populations and
the "Shifting Balance". Genetics.

Evolution of Sex
1.  Muller, H.J. 1964. The relation of recombination to mutational advance.
Mutation Res. 1(1):2-9

2. McDonald et al. 2016. Sex speeds adaptation by altering the dynamics of
molecular evolution. Nature.

Kin Selection, Cooperation, and Conflict
1. Hamilton, W. D. 1964. The genetical evolution of social behaviour I.
Journal of Theoretical Biology. 7:1-52.

2. Trivers, R. L. 1974 Parent-offspring conflict. American Zoologist.
14(1):249-264.

Sexual Selection
1. Zahavi, A. 1975. Mate selection - a selection of a handicap. J. Theor.
Biol. 53:205-214.

2. Kirkpatrick, M., and Ryan, M.J. 1991. The evolution of mating
preferences and the paradox of the lek. Nature. 350:33-38.

Fitness Landscapes
1. Dean, A. 1995. A Molecular Investigation of Genotype by Environment
Interactions. Genetics. 139:19-33.

2. Costanzo et al. 2010. The Genetic Landscape of a Cell. Science.

Speciation
1. Coyne, J. A., and H. A. Orr. 1989. Patterns of speciation in Drosophila.
Evolution. 43:362-381.

2. Corbett-Detig et al. 2013. Genetic incompatibilities are widespread
within species. Nature.

2.       *Marcos Antezana:*

Valen, L. v. 1975. Energy and Evolution. University of Chicago, Department
of Biology.

3.       *Remco Folkertsma:*

1. The work by Hopi Hoekstra on local adaptation and oldfield mice

2. Poelstra, J. W., Vijay, N., Bossu, C. M., Lantz, H., Ryll, B., M&uuml;ller,
I., ... &amp; Wolf, J. B. (2014). The genomic landscape underlying phenotypic
integrity in the face of gene flow in crows. Science, 344(6190), 1410-1414.

4.       *Joshka Kaufmann and Leslie Turner*

They offer us a link to 'papers every evolutionary biologist should read',
the papers are collected by Leslie Turner.
https://static1.squarespace.com/static/53e8cb7ce4b02c4bc3aeeee4/t/5ab8fcb670a6ad55c67fcdf4/1522072758665/EvoBioClassicsRefList.pdf

5.       *Sarah Stockwell*

Matt Ridley collected classic papers in evolutionary biology and printed
part of these papers in his book Evolution (see Matt Ridley. Evolution
(Univ. of Oxford Press, 2nd edition, 2004))
</pre>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42552/bioinformatics-workbook</guid>
	<pubDate>Tue, 05 Jan 2021 22:42:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42552/bioinformatics-workbook</link>
	<title><![CDATA[bioinformatics workbook]]></title>
	<description><![CDATA[<p><span>This books assumes that the reader has some knowledge of biology and basic understanding of the Unix command line. However, for the beginner, the appendix contains introductory material and tips/tricks for common bioinformatic problems, that is referred to for more information throughout the book.</span></p>
<p>https://bioinformaticsworkbook.org/</p><p>Address of the bookmark: <a href="https://bioinformaticsworkbook.org/" rel="nofollow">https://bioinformaticsworkbook.org/</a></p>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</guid>
	<pubDate>Fri, 27 Aug 2021 01:31:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43323/biostarhandbook</link>
	<title><![CDATA[biostarhandbook]]></title>
	<description><![CDATA[<p>Nice book collection for bioinformatician ... highly recommended.</p><p>Address of the bookmark: <a href="https://www.biostarhandbook.com/" rel="nofollow">https://www.biostarhandbook.com/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38169/amstat-display-statistics-of-large-sequence-files-from-next-generation-sequencing-projects</guid>
	<pubDate>Fri, 09 Nov 2018 13:34:56 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38169/amstat-display-statistics-of-large-sequence-files-from-next-generation-sequencing-projects</link>
	<title><![CDATA[AMStat: display statistics of large sequence files from next generation sequencing projects]]></title>
	<description><![CDATA[<p><span>SAMStat is an efficient C program to quickly display statistics of large sequence files from next generation sequencing projects. When applied to&nbsp;</span><a href="http://samstat.sourceforge.net/#about">SAM/BAM</a><span>&nbsp;files all statistics are reported for unmapped, poorly and accurately mapped reads separately. This allows for identification of a variety of problems, such as remaining linker and adaptor sequences, causing poor mapping. Apart from this SAMStat can be used to verify individual processing steps in large analysis pipelines.</span></p><p>Address of the bookmark: <a href="http://samstat.sourceforge.net/" rel="nofollow">http://samstat.sourceforge.net/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/1467/biopython-cookbook</guid>
	<pubDate>Thu, 08 Aug 2013 06:43:02 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/1467/biopython-cookbook</link>
	<title><![CDATA[BioPython Cookbook]]></title>
	<description><![CDATA[<p>If you are planning to start learning BioPython ( it does not bite but&nbsp;swallow :P just kidding) then this online cookbook will be really helpful for you.</p><p>http://biopython.org/DIST/docs/tutorial/Tutorial.html</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/17926/orange-bioinformatics-2534</guid>
	<pubDate>Mon, 06 Oct 2014 12:51:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/17926/orange-bioinformatics-2534</link>
	<title><![CDATA[Orange-Bioinformatics 2.5.34]]></title>
	<description><![CDATA[<p>Orange Bioinformatics extends <a href="http://orange.biolab.si/">Orange</a>, a data mining software package, with common functionality for bioinformatics. The provided functionality can be accessed as a Python library or through a visual programming interface (Orange Canvas). The latter is also suitable for non-programmers.</p>
<p>Orange Bioinformatics provides access to publicly available data, like GEO data sets, Biomart, GO, KEGG, Atlas, ArrayExpress, and PIPAx database. As for the analytics, there is gene selection, quality control, scoring distances between experiments with multiple factors. All features can be combined with powerful visualization, network exploration and data mining techniques from the Orange data mining framework.</p><p>Address of the bookmark: <a href="https://pypi.python.org/pypi/Orange-Bioinformatics/2.5.34" rel="nofollow">https://pypi.python.org/pypi/Orange-Bioinformatics/2.5.34</a></p>]]></description>
	<dc:creator>Robert M Willioms</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26627/scientist-computational-genomics-two-positions</guid>
  <pubDate>Sat, 12 Mar 2016 18:07:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist - Computational Genomics (Two Positions)]]></title>
  <description><![CDATA[
<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.</p>

<p>ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.</p>

<p>Responsibilities:Design efficient SQL queries for pulling large sequencing projects.<br />Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.<br />Develop and oversee a rapid and incremental software development and release schedule.<br />Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.<br />Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.<br />Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.<br />Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.<br />Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.<br />Assist in training of breeders in the CGIAR centers to use software developed.<br /> Personal Profile:</p>

<p>The applicant should have:</p>

<p>Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL<br />High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.<br />She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.<br />Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.<br />Ability to mentor colleagues in quality software development practices is desired.<br />Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.</p>

<p>More at http://www.icrisat.org/careers/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37586/julia-programming-language-a-python-and-r-rival</guid>
	<pubDate>Sat, 25 Aug 2018 04:46:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37586/julia-programming-language-a-python-and-r-rival</link>
	<title><![CDATA[Julia Programming Language, a Python and R rival]]></title>
	<description><![CDATA[<p>Big data has grown to become one of the most lucrative fields. In fact, data scientists are some of the most sought people. They are usually hired to analyze, control and parse large chunks of data. Implementing these actions using traditional techniques is not a walk in the park. This is why most data scientists prefer using programming languages such as R and Python. However, there is one more programming language that can do the job. That is Julia programming language.</p><p>What Is Julia Language?</p><p>Julia is a programming language that came into the limelight in 2012. It is a general-purpose programming language that was designed for solving scientific computations. Julia was meant to be an alternative to Python, R and other programming languages that were mainly used for manipulating data. This is because it has numerous features that can minimize the complexities of numerical computations.&nbsp;</p><p>Julia optimizes on the best features of Python and R while at the same time overlooks their weaknesses. This explains why it is viewed as an alternative to these programming languages. For instance, it utilizes the readability and simplicity of Python then performs faster.</p><p>Julia is the most preferred programming language for data scientists and mathematicians. This is because its core features are similar to the ones that are used on most data software. Also, the language is ideal for these two subjects because its syntax is similar to the standard mathematical formulas.</p><p>Key Features Of Julia Language<br />Uses JIT Compilation<br />Parallelism<br />Dynamic Typing<br />Simple Syntax<br />Allows Metaprogramming<br />Accessible to Libraries<br />-1-Array Indexing</p><p>Julia Vs Python And R Programming Languages<br />1. Speed<br />Julia is faster than both Python and R. This is a very critical aspect that is given special attention in the big data programming. The high speed of Julia is because of JIT compilers. You will need to install external libraries on Python to achieve similar speed.</p><p>2. Syntax<br />Julia has a math-friendly syntax. The syntax of this programming language is similar to the mathematical formulas hence can be used to perform mathematical and scientific computations. This syntax makes it easier to learn than Python.</p><p>3. Parallelism<br />Although both Python and R use parallelism, Julia uses a top-level parallelism. Julia allows the processor to perform to the optimum level than what Python and R can achieve.</p><p>4. Versatility<br />Julia programming language is more versatile than Python and R. It allows a programmer to move from different codes and functions with ease.</p><p>The only area that Python and R are superior to Julia is in terms of community. Given that Julia is a new programming language, it has a small community as compared to others which have been around for years.</p><p>In overall Julia programming language is a better alternative that you can use to handle Big data projects. Despite having a small community, it is one of those programming languages that you can easily learn.</p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40298/environment-for-tree-exploration-ete-is-a-python-programming-toolkit-that-assists-in-the-recontruction-manipulation-analysis-and-visualization-of-phylogenetic-trees</guid>
	<pubDate>Wed, 27 Nov 2019 05:32:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40298/environment-for-tree-exploration-ete-is-a-python-programming-toolkit-that-assists-in-the-recontruction-manipulation-analysis-and-visualization-of-phylogenetic-trees</link>
	<title><![CDATA[Environment for Tree Exploration (ETE) is a Python programming toolkit that assists in the recontruction, manipulation, analysis and visualization of phylogenetic trees]]></title>
	<description><![CDATA[<p><span>The Environment for Tree Exploration (ETE) is a Python programming toolkit that assists in the recontruction, manipulation, analysis and visualization of phylogenetic trees (although clustering trees or any other tree-like data structure are also supported).</span></p>
<p><span>Other tools</span></p>
<p><span><a href="https://github.com/shenwei356/taxonkit">https://github.com/shenwei356/taxonkit</a></span></p>
<p>&nbsp;</p>
<ul>
<li>ETE, version:&nbsp;<a href="https://pypi.org/project/ete3/3.1.1/">3.1.1</a></li>
<li>BioPython, version:&nbsp;<a href="https://pypi.org/project/biopython/1.73/">1.73</a></li>
<li>taxadb, version:&nbsp;<a href="https://pypi.org/project/taxadb/0.9.0">0.10.1</a></li>
<li>TaxonKit, version:&nbsp;<a href="https://github.com/shenwei356/taxonkit/releases/tag/0.10.1">0.5.0</a></li>
</ul><p>Address of the bookmark: <a href="https://pypi.org/project/ete3/3.1.1/" rel="nofollow">https://pypi.org/project/ete3/3.1.1/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>