<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44648?offset=90</link>
	<atom:link href="https://bioinformaticsonline.com/related/44648?offset=90" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44307/genomenotebook</guid>
	<pubDate>Thu, 20 Apr 2023 13:19:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44307/genomenotebook</link>
	<title><![CDATA[genomenotebook]]></title>
	<description><![CDATA[<p><a href="https://dbikard.github.io/genomenotebook/">https://dbikard.github.io/genomenotebook/</a></p>
<h2>Install<a href="https://dbikard.github.io/genomenotebook/#install"></a></h2>
<pre><code>pip install genomenotebook</code></pre>
<h2>How to use<a href="https://dbikard.github.io/genomenotebook/#how-to-use"></a></h2>
<p>Create a simple genome browser with a search bar. The sequence appears when zooming in.</p>
<div>
<div id="cb2">
<pre><code><span><a href="https://dbikard.github.io/genomenotebook/#cb2-1"></a><span>import</span> genomenotebook <span>as</span> gn</span>
<span><a href="https://dbikard.github.io/genomenotebook/#cb2-2"></a></span>
<span><a href="https://dbikard.github.io/genomenotebook/#cb2-3"></a>g<span>=</span>gn.GenomeBrowser(genome_path, gff_path, init_pos<span>=</span><span>10000</span>)</span>
<span><a href="https://dbikard.github.io/genomenotebook/#cb2-4"></a>g.show()</span></code><button title="Copy to Clipboard"></button></pre>
</div>
</div>
<p>Tracks can be added to visualize your favorite genomics data. See&nbsp;<code>Examples</code>&nbsp;for more !!!!</p><p>Address of the bookmark: <a href="https://dbikard.github.io/genomenotebook/" rel="nofollow">https://dbikard.github.io/genomenotebook/</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/21703/coding-ground</guid>
	<pubDate>Tue, 17 Mar 2015 00:47:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/21703/coding-ground</link>
	<title><![CDATA[Coding Ground]]></title>
	<description><![CDATA[<p>Online coding group for most of the programming languages.</p>
<p>Code in almost all popular languages using Coding Ground.&nbsp;Edit, compile, execute and share your projects, 100% cloud.</p>
<p>http://www.tutorialspoint.com/codingground.htm</p><p>Address of the bookmark: <a href="http://www.tutorialspoint.com/codingground.htm" rel="nofollow">http://www.tutorialspoint.com/codingground.htm</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33398/tiny-python36-notebook</guid>
	<pubDate>Sat, 03 Jun 2017 03:16:28 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33398/tiny-python36-notebook</link>
	<title><![CDATA[Tiny Python3.6 Notebook]]></title>
	<description><![CDATA[<p><span>This is not so much an instructional manual, but rather notes, tables, and examples for Python syntax. It was created by the author as an additional resource during training, meant to be distributed as a physical notebook. Participants (who favor the physical characteristics of dead tree material) could add their own notes, thoughts, and have a valuable reference of curated examples.</span></p><p>Address of the bookmark: <a href="https://github.com/mattharrison/Tiny-Python-3.6-Notebook/blob/master/python.rst" rel="nofollow">https://github.com/mattharrison/Tiny-Python-3.6-Notebook/blob/master/python.rst</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/39307/awk-for-beginners</guid>
	<pubDate>Fri, 26 Apr 2019 16:19:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/39307/awk-for-beginners</link>
	<title><![CDATA[AWK for beginners !]]></title>
	<description><![CDATA[<p>AWK is a standard tool on every POSIX-compliant UNIX system. It&rsquo;s like flex/lex, from the command-line, perfect for text-processing tasks and other scripting needs. It has a C-like syntax, but without mandatory semicolons (although, you should use them anyway, because they are required when you&rsquo;re writing one-liners, something AWK excels at), manual memory management, or static typing. It excels at text processing. You can call to it from a shell script, or you can use it as a stand-alone scripting language.</p><p>Why use AWK instead of Perl? Readability. AWK is easier to read than Perl. For simple text-processing scripts, particularly ones that read files line by line and split on delimiters, AWK is probably the right tool for the job.</p><div><pre><span>#!/usr/bin/awk -f</span>

<span># Comments are like this</span>


<span># AWK programs consist of a collection of patterns and actions.</span>
<span>pattern1</span> <span>{</span> <span>action</span><span>;</span> <span>}</span> <span># just like lex</span>
<span>pattern2</span> <span>{</span> <span>action</span><span>;</span> <span>}</span>

<span># There is an implied loop and AWK automatically reads and parses each</span>
<span># record of each file supplied. Each record is split by the FS delimiter,</span>
<span># which defaults to white-space (multiple spaces,tabs count as one)</span>
<span># You can assign FS either on the command line (-F C) or in your BEGIN</span>
<span># pattern</span>

<span># One of the special patterns is BEGIN. The BEGIN pattern is true</span>
<span># BEFORE any of the files are read. The END pattern is true after</span>
<span># an End-of-file from the last file (or standard-in if no files specified)</span>
<span># There is also an output field separator (OFS) that you can assign, which</span>
<span># defaults to a single space</span>

<span>BEGIN</span> <span>{</span>

    <span># BEGIN will run at the beginning of the program. It's where you put all</span>
    <span># the preliminary set-up code, before you process any text files. If you</span>
    <span># have no text files, then think of BEGIN as the main entry point.</span>

    <span># Variables are global. Just set them or use them, no need to declare..</span>
    <span>count</span> <span>=</span> <span>0</span><span>;</span>

    <span># Operators just like in C and friends</span>
    <span>a</span> <span>=</span> <span>count</span> <span>+</span> <span>1</span><span>;</span>
    <span>b</span> <span>=</span> <span>count</span> <span>-</span> <span>1</span><span>;</span>
    <span>c</span> <span>=</span> <span>count</span> <span>*</span> <span>1</span><span>;</span>
    <span>d</span> <span>=</span> <span>count</span> <span>/</span> <span>1</span><span>;</span> <span># integer division</span>
    <span>e</span> <span>=</span> <span>count</span> <span>%</span> <span>1</span><span>;</span> <span># modulus</span>
    <span>f</span> <span>=</span> <span>count</span> <span>^</span> <span>1</span><span>;</span> <span># exponentiation</span>

    <span>a</span> <span>+=</span> <span>1</span><span>;</span>
    <span>b</span> <span>-=</span> <span>1</span><span>;</span>
    <span>c</span> <span>*=</span> <span>1</span><span>;</span>
    <span>d</span> <span>/=</span> <span>1</span><span>;</span>
    <span>e</span> <span>%=</span> <span>1</span><span>;</span>
    <span>f</span> <span>^=</span> <span>1</span><span>;</span>

    <span># Incrementing and decrementing by one</span>
    <span>a</span><span>++</span><span>;</span>
    <span>b</span><span>--</span><span>;</span>

    <span># As a prefix operator, it returns the incremented value</span>
    <span>++</span><span>a</span><span>;</span>
    <span>--</span><span>b</span><span>;</span>

    <span># Notice, also, no punctuation such as semicolons to terminate statements</span>

    <span># Control statements</span>
    <span>if</span> <span>(</span><span>count</span> <span>==</span> <span>0</span><span>)</span>
        <span>print</span> <span>"Starting with count of 0"</span><span>;</span>
    <span>else</span>
        <span>print</span> <span>"Huh?"</span><span>;</span>

    <span># Or you could use the ternary operator</span>
    <span>print</span> <span>(</span><span>count</span> <span>==</span> <span>0</span><span>)</span> <span>?</span> <span>"Starting with count of 0"</span> <span>:</span> <span>"Huh?"</span><span>;</span>

    <span># Blocks consisting of multiple lines use braces</span>
    <span>while</span> <span>(</span><span>a</span> <span>&lt;</span> <span>10</span><span>)</span> <span>{</span>
        <span>print</span> <span>"String concatenation is done"</span> <span>" with a series"</span> <span>" of"</span>
            <span>" space-separated strings"</span><span>;</span>
        <span>print</span> <span>a</span><span>;</span>

        <span>a</span><span>++</span><span>;</span>
    <span>}</span>

    <span>for</span> <span>(</span><span>i</span> <span>=</span> <span>0</span><span>;</span> <span>i</span> <span>&lt;</span> <span>10</span><span>;</span> <span>i</span><span>++</span><span>)</span>
        <span>print</span> <span>"Good ol' for loop"</span><span>;</span>

    <span># As for comparisons, they're the standards:</span>
    <span># a &lt; b   # Less than</span>
    <span># a &lt;= b  # Less than or equal</span>
    <span># a != b  # Not equal</span>
    <span># a == b  # Equal</span>
    <span># a &gt; b   # Greater than</span>
    <span># a &gt;= b  # Greater than or equal</span>

    <span># Logical operators as well</span>
    <span># a &amp;&amp; b  # AND</span>
    <span># a || b  # OR</span>

    <span># In addition, there's the super useful regular expression match</span>
    <span>if</span> <span>(</span><span>"foo"</span> <span>~</span> <span>"^fo+$"</span><span>)</span>
        <span>print</span> <span>"Fooey!"</span><span>;</span>
    <span>if</span> <span>(</span><span>"boo"</span> <span>!~</span> <span>"^fo+$"</span><span>)</span>
        <span>print</span> <span>"Boo!"</span><span>;</span>

    <span># Arrays</span>
    <span>arr</span><span>[</span><span>0</span><span>]</span> <span>=</span> <span>"foo"</span><span>;</span>
    <span>arr</span><span>[</span><span>1</span><span>]</span> <span>=</span> <span>"bar"</span><span>;</span>

    <span># You can also initialize an array with the built-in function split()</span>

    <span>n</span> <span>=</span> <span>split</span><span>(</span><span>"foo:bar:baz"</span><span>,</span> <span>arr</span><span>,</span> <span>":"</span><span>);</span>

    <span># You also have associative arrays (actually, they're all associative arrays)</span>
    <span>assoc</span><span>[</span><span>"foo"</span><span>]</span> <span>=</span> <span>"bar"</span><span>;</span>
    <span>assoc</span><span>[</span><span>"bar"</span><span>]</span> <span>=</span> <span>"baz"</span><span>;</span>

    <span># And multi-dimensional arrays, with some limitations I won't mention here</span>
    <span>multidim</span><span>[</span><span>0</span><span>,</span><span>0</span><span>]</span> <span>=</span> <span>"foo"</span><span>;</span>
    <span>multidim</span><span>[</span><span>0</span><span>,</span><span>1</span><span>]</span> <span>=</span> <span>"bar"</span><span>;</span>
    <span>multidim</span><span>[</span><span>1</span><span>,</span><span>0</span><span>]</span> <span>=</span> <span>"baz"</span><span>;</span>
    <span>multidim</span><span>[</span><span>1</span><span>,</span><span>1</span><span>]</span> <span>=</span> <span>"boo"</span><span>;</span>

    <span># You can test for array membership</span>
    <span>if</span> <span>(</span><span>"foo"</span> <span>in</span> <span>assoc</span><span>)</span>
        <span>print</span> <span>"Fooey!"</span><span>;</span>

    <span># You can also use the 'in' operator to traverse the keys of an array</span>
    <span>for</span> <span>(</span><span>key</span> <span>in</span> <span>assoc</span><span>)</span>
        <span>print</span> <span>assoc</span><span>[</span><span>key</span><span>];</span>

    <span># The command line is in a special array called ARGV</span>
    <span>for</span> <span>(</span><span>argnum</span> <span>in</span> <span>ARGV</span><span>)</span>
        <span>print</span> <span>ARGV</span><span>[</span><span>argnum</span><span>];</span>

    <span># You can remove elements of an array</span>
    <span># This is particularly useful to prevent AWK from assuming the arguments</span>
    <span># are files for it to process</span>
    <span>delete</span> <span>ARGV</span><span>[</span><span>1</span><span>];</span>

    <span># The number of command line arguments is in a variable called ARGC</span>
    <span>print</span> <span>ARGC</span><span>;</span>

    <span># AWK has several built-in functions. They fall into three categories. I'll</span>
    <span># demonstrate each of them in their own functions, defined later.</span>

    <span>return_value</span> <span>=</span> <span>arithmetic_functions</span><span>(</span><span>a</span><span>,</span> <span>b</span><span>,</span> <span>c</span><span>);</span>
    <span>string_functions</span><span>();</span>
    <span>io_functions</span><span>();</span>
<span>}</span>

<span># Here's how you define a function</span>
<span>function</span> <span>arithmetic_functions</span><span>(</span><span>a</span><span>,</span> <span>b</span><span>,</span> <span>c</span><span>,</span>     <span>d</span><span>)</span> <span>{</span>

    <span># Probably the most annoying part of AWK is that there are no local</span>
    <span># variables. Everything is global. For short scripts, this is fine, even</span>
    <span># useful, but for longer scripts, this can be a problem.</span>

    <span># There is a work-around (ahem, hack). Function arguments are local to the</span>
    <span># function, and AWK allows you to define more function arguments than it</span>
    <span># needs. So just stick local variable in the function declaration, like I</span>
    <span># did above. As a convention, stick in some extra whitespace to distinguish</span>
    <span># between actual function parameters and local variables. In this example,</span>
    <span># a, b, and c are actual parameters, while d is merely a local variable.</span>

    <span># Now, to demonstrate the arithmetic functions</span>

    <span># Most AWK implementations have some standard trig functions</span>
    <span>localvar</span> <span>=</span> <span>sin</span><span>(</span><span>a</span><span>);</span>
    <span>localvar</span> <span>=</span> <span>cos</span><span>(</span><span>a</span><span>);</span>
    <span>localvar</span> <span>=</span> <span>atan2</span><span>(</span><span>b</span><span>,</span> <span>a</span><span>);</span> <span># arc tangent of b / a</span>

    <span># And logarithmic stuff</span>
    <span>localvar</span> <span>=</span> <span>exp</span><span>(</span><span>a</span><span>);</span>
    <span>localvar</span> <span>=</span> <span>log</span><span>(</span><span>a</span><span>);</span>

    <span># Square root</span>
    <span>localvar</span> <span>=</span> <span>sqrt</span><span>(</span><span>a</span><span>);</span>

    <span># Truncate floating point to integer</span>
    <span>localvar</span> <span>=</span> <span>int</span><span>(</span><span>5.34</span><span>);</span> <span># localvar =&gt; 5</span>

    <span># Random numbers</span>
    <span>srand</span><span>();</span> <span># Supply a seed as an argument. By default, it uses the time of day</span>
    <span>localvar</span> <span>=</span> <span>rand</span><span>();</span> <span># Random number between 0 and 1.</span>

    <span># Here's how to return a value</span>
    <span>return</span> <span>localvar</span><span>;</span>
<span>}</span>

<span>function</span> <span>string_functions</span><span>(</span>    <span>localvar</span><span>,</span> <span>arr</span><span>)</span> <span>{</span>

    <span># AWK, being a string-processing language, has several string-related</span>
    <span># functions, many of which rely heavily on regular expressions.</span>

    <span># Search and replace, first instance (sub) or all instances (gsub)</span>
    <span># Both return number of matches replaced</span>
    <span>localvar</span> <span>=</span> <span>"fooooobar"</span><span>;</span>
    <span>sub</span><span>(</span><span>"fo+"</span><span>,</span> <span>"Meet me at the "</span><span>,</span> <span>localvar</span><span>);</span> <span># localvar =&gt; "Meet me at the bar"</span>
    <span>gsub</span><span>(</span><span>"e+"</span><span>,</span> <span>"."</span><span>,</span> <span>localvar</span><span>);</span> <span># localvar =&gt; "m..t m. at th. bar"</span>

    <span># Search for a string that matches a regular expression</span>
    <span># index() does the same thing, but doesn't allow a regular expression</span>
    <span>match</span><span>(</span><span>localvar</span><span>,</span> <span>"t"</span><span>);</span> <span># =&gt; 4, since the 't' is the fourth character</span>

    <span># Split on a delimiter</span>
    <span>n</span> <span>=</span> <span>split</span><span>(</span><span>"foo-bar-baz"</span><span>,</span> <span>arr</span><span>,</span> <span>"-"</span><span>);</span> <span># a[1] = "foo"; a[2] = "bar"; a[3] = "baz"; n = 3</span>

    <span># Other useful stuff</span>
    <span>sprintf</span><span>(</span><span>"%s %d %d %d"</span><span>,</span> <span>"Testing"</span><span>,</span> <span>1</span><span>,</span> <span>2</span><span>,</span> <span>3</span><span>);</span> <span># =&gt; "Testing 1 2 3"</span>
    <span>substr</span><span>(</span><span>"foobar"</span><span>,</span> <span>2</span><span>,</span> <span>3</span><span>);</span> <span># =&gt; "oob"</span>
    <span>substr</span><span>(</span><span>"foobar"</span><span>,</span> <span>4</span><span>);</span> <span># =&gt; "bar"</span>
    <span>length</span><span>(</span><span>"foo"</span><span>);</span> <span># =&gt; 3</span>
    <span>tolower</span><span>(</span><span>"FOO"</span><span>);</span> <span># =&gt; "foo"</span>
    <span>toupper</span><span>(</span><span>"foo"</span><span>);</span> <span># =&gt; "FOO"</span>
<span>}</span>

<span>function</span> <span>io_functions</span><span>(</span>    <span>localvar</span><span>)</span> <span>{</span>

    <span># You've already seen print</span>
    <span>print</span> <span>"Hello world"</span><span>;</span>

    <span># There's also printf</span>
    <span>printf</span><span>(</span><span>"%s %d %d %d\n"</span><span>,</span> <span>"Testing"</span><span>,</span> <span>1</span><span>,</span> <span>2</span><span>,</span> <span>3</span><span>);</span>

    <span># AWK doesn't have file handles, per se. It will automatically open a file</span>
    <span># handle for you when you use something that needs one. The string you used</span>
    <span># for this can be treated as a file handle, for purposes of I/O. This makes</span>
    <span># it feel sort of like shell scripting, but to get the same output, the string</span>
    <span># must match exactly, so use a variable:</span>

    <span>outfile</span> <span>=</span> <span>"/tmp/foobar.txt"</span><span>;</span>

    <span>print</span> <span>"foobar"</span> <span>&gt;</span> <span>outfile</span><span>;</span>

    <span># Now the string outfile is a file handle. You can close it:</span>
    <span>close</span><span>(</span><span>outfile</span><span>);</span>

    <span># Here's how you run something in the shell</span>
    <span>system</span><span>(</span><span>"echo foobar"</span><span>);</span> <span># =&gt; prints foobar</span>

    <span># Reads a line from standard input and stores in localvar</span>
    <span>getline</span> <span>localvar</span><span>;</span>

    <span># Reads a line from a pipe (again, use a string so you close it properly)</span>
    <span>cmd</span> <span>=</span> <span>"echo foobar"</span><span>;</span>
    <span>cmd</span> <span>|</span> <span>getline</span> <span>localvar</span><span>;</span> <span># localvar =&gt; "foobar"</span>
    <span>close</span><span>(</span><span>cmd</span><span>);</span>

    <span># Reads a line from a file and stores in localvar</span>
    <span>infile</span> <span>=</span> <span>"/tmp/foobar.txt"</span><span>;</span>
    <span>getline</span> <span>localvar</span> <span>&lt;</span> <span>infile</span><span>;</span> 
    <span>close</span><span>(</span><span>infile</span><span>);</span>
<span>}</span>

<span># As I said at the beginning, AWK programs consist of a collection of patterns</span>
<span># and actions. You've already seen the BEGIN pattern. Other</span>
<span># patterns are used only if you're processing lines from files or standard</span>
<span># input.</span>
<span>#</span>
<span># When you pass arguments to AWK, they are treated as file names to process.</span>
<span># It will process them all, in order. Think of it like an implicit for loop,</span>
<span># iterating over the lines in these files. these patterns and actions are like</span>
<span># switch statements inside the loop. </span>

<span>/^fo+bar$/</span> <span>{</span>

    <span># This action will execute for every line that matches the regular</span>
    <span># expression, /^fo+bar$/, and will be skipped for any line that fails to</span>
    <span># match it. Let's just print the line:</span>

    <span>print</span><span>;</span>

    <span># Whoa, no argument! That's because print has a default argument: $0.</span>
    <span># $0 is the name of the current line being processed. It is created</span>
    <span># automatically for you.</span>

    <span># You can probably guess there are other $ variables. Every line is</span>
    <span># implicitly split before every action is called, much like the shell</span>
    <span># does. And, like the shell, each field can be access with a dollar sign</span>

    <span># This will print the second and fourth fields in the line</span>
    <span>print</span> <span>$</span><span>2</span><span>,</span> <span>$</span><span>4</span><span>;</span>

    <span># AWK automatically defines many other variables to help you inspect and</span>
    <span># process each line. The most important one is NF</span>

    <span># Prints the number of fields on this line</span>
    <span>print</span> <span>NF</span><span>;</span>

    <span># Print the last field on this line</span>
    <span>print</span> <span>$</span><span>NF</span><span>;</span>
<span>}</span>

<span># Every pattern is actually a true/false test. The regular expression in the</span>
<span># last pattern is also a true/false test, but part of it was hidden. If you</span>
<span># don't give it a string to test, it will assume $0, the line that it's</span>
<span># currently processing. Thus, the complete version of it is this:</span>

<span>$</span><span>0</span> <span>~</span> <span>/^fo+bar$/</span> <span>{</span>
    <span>print</span> <span>"Equivalent to the last pattern"</span><span>;</span>
<span>}</span>

<span>a</span> <span>&gt;</span> <span>0</span> <span>{</span>
    <span># This will execute once for each line, as long as a is positive</span>
<span>}</span>

<span># You get the idea. Processing text files, reading in a line at a time, and</span>
<span># doing something with it, particularly splitting on a delimiter, is so common</span>
<span># in UNIX that AWK is a scripting language that does all of it for you, without</span>
<span># you needing to ask. All you have to do is write the patterns and actions</span>
<span># based on what you expect of the input, and what you want to do with it.</span>

<span># Here's a quick example of a simple script, the sort of thing AWK is perfect</span>
<span># for. It will read a name from standard input and then will print the average</span>
<span># age of everyone with that first name. Let's say you supply as an argument the</span>
<span># name of a this data file:</span>
<span>#</span>
<span># Bob Jones 32</span>
<span># Jane Doe 22</span>
<span># Steve Stevens 83</span>
<span># Bob Smith 29</span>
<span># Bob Barker 72</span>
<span>#</span>
<span># Here's the script:</span>

<span>BEGIN</span> <span>{</span>

    <span># First, ask the user for the name</span>
    <span>print</span> <span>"What name would you like the average age for?"</span><span>;</span>

    <span># Get a line from standard input, not from files on the command line</span>
    <span>getline</span> <span>name</span> <span>&lt;</span> <span>"/dev/stdin"</span><span>;</span>
<span>}</span>

<span># Now, match every line whose first field is the given name</span>
<span>$</span><span>1</span> <span>==</span> <span>name</span> <span>{</span>

    <span># Inside here, we have access to a number of useful variables, already</span>
    <span># pre-loaded for us:</span>
    <span># $0 is the entire line</span>
    <span># $3 is the third field, the age, which is what we're interested in here</span>
    <span># NF is the number of fields, which should be 3</span>
    <span># NR is the number of records (lines) seen so far</span>
    <span># FILENAME is the name of the file being processed</span>
    <span># FS is the field separator being used, which is " " here</span>
    <span># ...etc. There are plenty more, documented in the man page.</span>

    <span># Keep track of a running total and how many lines matched</span>
    <span>sum</span> <span>+=</span> <span>$</span><span>3</span><span>;</span>
    <span>nlines</span><span>++</span><span>;</span>
<span>}</span>

<span># Another special pattern is called END. It will run after processing all the</span>
<span># text files. Unlike BEGIN, it will only run if you've given it input to</span>
<span># process. It will run after all the files have been read and processed</span>
<span># according to the rules and actions you've provided. The purpose of it is</span>
<span># usually to output some kind of final report, or do something with the</span>
<span># aggregate of the data you've accumulated over the course of the script.</span>

<span>END</span> <span>{</span>
    <span>if</span> <span>(</span><span>nlines</span><span>)</span>
        <span>print</span> <span>"The average age for "</span> <span>name</span> <span>" is "</span> <span>sum</span> <span>/</span> <span>nlines</span><span>;</span>
<span>}</span>
</pre><p><span>&nbsp;</span></p></div>]]></description>
	<dc:creator>BioJoker</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/42813/bioinformatics-in-africa-part5-nigeria</guid>
	<pubDate>Sat, 06 Feb 2021 21:13:47 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/42813/bioinformatics-in-africa-part5-nigeria</link>
	<title><![CDATA[Bioinformatics in Africa: Part5 - Nigeria]]></title>
	<description><![CDATA[<p>Covenant University (CU)&shy;Ota:<br />Covenant University (with her enriching and growing state&shy;of&shy;the&shy;art laboratories in the area of &nbsp;science and technology, arts, business and social sciences) is presently the Best University in &nbsp;Nigeria (Private University category), based on the recent over&shy;all rating just concluded by the &nbsp;Nigeria &nbsp; University &nbsp; Commission &nbsp; (NUC). &nbsp; Recently, &nbsp; Covenant &nbsp; University &nbsp; has &nbsp; initiated &nbsp; the &nbsp;establishment of a Centre for Applied Biotech, Bio&shy;Informatics and Microbiology (CBBM) to be &nbsp;situated at the University. The institute has been designed to be a Public&shy;Private Partnership for a productive synergy b/w Academia, Industry and Government. The whole concept is still evolving &nbsp;and more details will be release soon. As regards CBBM, a dedicated computing lab is in plan, but even our computing capacity is &nbsp;presently enormous. In the department of Computer and Information Sciences, we have more than &nbsp;250 Pentium 4 PCs set aside for teaching and research purposes. Furthermore, we have several &nbsp;moderate speed PCs at the Postgraduate research lab and our engineering departments and units. &nbsp;Our wet lab facilities is presently minimal (basic for teaching), the Centre requirement as it touches &nbsp;the wet&shy;laboratories is also set to upgrade this to basic tools expected at an international centre of learning.</p><p>University&nbsp;of&nbsp;Ibadan&nbsp;(UIB)&shy;Ibadan:<br />There&nbsp;has&nbsp;been&nbsp;significant&nbsp;increase&nbsp;in&nbsp;the&nbsp;number&nbsp;of&nbsp;bioinformatics&nbsp;activities&nbsp;in&nbsp;Nigeria&nbsp;(and&nbsp;West Africa)&nbsp;since&nbsp;2003&nbsp;when&nbsp;the&nbsp;program&nbsp;was&nbsp;initiated&nbsp;by&nbsp;the&nbsp;West&nbsp;African&nbsp;Biotechnology&nbsp;Workshops Series&nbsp;(WABWS,&nbsp;http://www.wabw.org)&nbsp;at&nbsp;the&nbsp;University&nbsp;of&nbsp;Ibadan,&nbsp;Nigeria&nbsp;(in&nbsp;collaboration&nbsp;with&nbsp; the&nbsp;South&nbsp;African&nbsp;National&nbsp;Bioinformatics&nbsp;Institute&nbsp;(SANBI,&nbsp;http:/www.sanbi.ac.za).&nbsp;Workshops&nbsp; that&nbsp;were&nbsp;open&nbsp;to&nbsp;scientists&nbsp;from&nbsp;all&nbsp;African&nbsp;countries&nbsp;have&nbsp;seen&nbsp;a&nbsp;very&nbsp;high&nbsp;number&nbsp;of&nbsp;applications&nbsp; from&nbsp;scientists&nbsp;based&nbsp;in&nbsp;West&nbsp;Africa.&nbsp;The&nbsp;encouraging&nbsp;desire&nbsp;to&nbsp;acquire&nbsp;cutting&shy;edge&nbsp;skills&nbsp;to&nbsp; computational&nbsp;process&nbsp;data&nbsp;and&nbsp;extract&nbsp;useful&nbsp;knowledge&nbsp;from&nbsp;genome&nbsp;projects&nbsp;led&nbsp;to&nbsp;the&nbsp;interest&nbsp;of&nbsp; the&nbsp;West&nbsp;African&nbsp;Biotechnology&nbsp;Workshops&nbsp;(WABW)&nbsp;to&nbsp;develop&nbsp;an&nbsp;agenda&nbsp;to&nbsp;address&nbsp;the&nbsp; bioinformatics&nbsp;skills&nbsp;gap&nbsp;among&nbsp;scientists&nbsp;in&nbsp;West&nbsp;Africa.&nbsp;An&nbsp;increased&nbsp;commitment&nbsp;from&nbsp;agencies&nbsp; like&nbsp;NEPAD&nbsp;would&nbsp;be&nbsp;required&nbsp;in&nbsp;the&nbsp;provision&nbsp;of&nbsp;infrastructure&nbsp;to&nbsp;establish&nbsp;and&nbsp;sustain&nbsp;regional&nbsp; and&nbsp;national&nbsp;networks.</p><p>University&nbsp;of&nbsp;Ilorin&nbsp;(UIL)&shy;Ilorin:<br />The&nbsp;University&nbsp;of&nbsp;Ilorin&nbsp;was&nbsp;established&nbsp;in&nbsp;1976&nbsp;by&nbsp;the&nbsp;Federal&nbsp;Government&nbsp;of&nbsp;Nigeria.&nbsp; Bioinformatics&nbsp;activities&nbsp;started&nbsp;at&nbsp;the&nbsp;University&nbsp;in&nbsp;February&nbsp;2003&nbsp;with&nbsp;the&nbsp;establishment&nbsp;of&nbsp;the&nbsp; West&nbsp;African&nbsp;Bioinformatics&nbsp;Research&nbsp;Initiative&nbsp;(WABRI).&nbsp;However,&nbsp;progress&nbsp;has&nbsp;been&nbsp;rather&nbsp;slow&nbsp; due&nbsp;to&nbsp;inadequate&nbsp;funding.&nbsp;We&nbsp;are&nbsp;mainly&nbsp;engaged&nbsp;in&nbsp;Bioinformatics&nbsp;training&nbsp;at&nbsp;the&nbsp;introductory&nbsp; level&nbsp;and&nbsp;proteomics&nbsp;studies&nbsp;on&nbsp;various&nbsp;species&nbsp;of&nbsp;malaria&nbsp;parasites.&nbsp;Recently,&nbsp;we&nbsp;became&nbsp;interested&nbsp; in&nbsp;comparative&nbsp;genome&nbsp;analysis&nbsp;of&nbsp;various&nbsp;species&nbsp;of &nbsp;Plasmodium&nbsp; and&nbsp;the&nbsp;comparison&nbsp;of&nbsp; chloroquine&nbsp;sensitive&nbsp;and&nbsp;chloroquine&nbsp;resistant&nbsp;strains&nbsp;of&nbsp;Plasmodium&nbsp;falciparum.&nbsp;Other&nbsp;activities&nbsp; and&nbsp;areas&nbsp;of&nbsp;interest&nbsp;can&nbsp;be&nbsp;seen&nbsp;on&nbsp;our&nbsp;website,&nbsp;http://www.wabri.org,&nbsp;although&nbsp;not&nbsp;all&nbsp;our&nbsp; proposed&nbsp;interests&nbsp;have&nbsp;been&nbsp;fully&nbsp;implemented&nbsp;due&nbsp;to&nbsp;our&nbsp;level&nbsp;of&nbsp;funding.</p><p>Training:<br />The&nbsp;University&nbsp;of&nbsp;Ilorin&nbsp;has&nbsp;introduced&nbsp;M.Sc.&nbsp;and&nbsp;Ph.D.&nbsp;programmes&nbsp;in&nbsp;Computer&nbsp;Science&nbsp;(with&nbsp; options&nbsp;in&nbsp;Bioinformatics).&nbsp;The&nbsp;programme&nbsp;is&nbsp;based&nbsp;in&nbsp;the&nbsp;Department&nbsp;of&nbsp;Computer&nbsp;Science&nbsp;and&nbsp; emphasis&nbsp;is&nbsp;on&nbsp;the&nbsp;development&nbsp;of&nbsp;algorithms&nbsp;to&nbsp;solve&nbsp;problems&nbsp;in&nbsp;bioinformatics. The&nbsp;Covenant&nbsp;University&nbsp;offers&nbsp;M.Sc.&nbsp;and&nbsp;Ph.D&nbsp;in&nbsp;Computer&nbsp;Science&nbsp;with&nbsp;option&nbsp;in&nbsp;Bioinformatics&nbsp; (Computational&nbsp;Biology).&nbsp;Furthermore,&nbsp;through&nbsp;affiliated&nbsp;departments,&nbsp;the&nbsp;CBBM&nbsp;is&nbsp;been&nbsp;design&nbsp;to&nbsp;award&nbsp;Diploma&nbsp;and&nbsp;Degree&nbsp;certificates&nbsp;in&nbsp;Biotechnology.</p><p>Web&nbsp;sites&nbsp;and&nbsp;links: http://www.covenantuniversity.com http://www.run.edu.ng http://www.uniben.edu http://www.wabri.org http://www.wabw.org http://www.unilorin.edu.ng http://www.wabri.org http://www.asopah.org</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43315/genome-assembly-workshop-2020</guid>
	<pubDate>Wed, 25 Aug 2021 04:30:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43315/genome-assembly-workshop-2020</link>
	<title><![CDATA[Genome Assembly Workshop 2020]]></title>
	<description><![CDATA[<p><span>Our team offers custom bioinformatics services to academic and private organizations. We have a strong academic background with a focus on cutting edge, open source software. We replicate standard analysis pipelines (best practices) when appropriate, and/or develop novel applications and pipelines when needed, however we always emphasize biological interpretation of the data.</span></p>
<p><span>More at&nbsp;https://ucdavis-bioinformatics-training.github.io/</span></p><p>Address of the bookmark: <a href="https://ucdavis-bioinformatics-training.github.io/2020-Genome_Assembly_Workshop/snakemake/snakemake_intro" rel="nofollow">https://ucdavis-bioinformatics-training.github.io/2020-Genome_Assembly_Workshop/snakemake/snakemake_intro</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43587/fix-rewritable-error-of-elgg</guid>
	<pubDate>Mon, 15 Nov 2021 06:23:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43587/fix-rewritable-error-of-elgg</link>
	<title><![CDATA[Fix rewritable error of ELGG !]]></title>
	<description><![CDATA[<p>The&nbsp;<code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;module uses a rule-based rewriting engine, based on a PCRE regular-expression parser, to rewrite requested URLs on the fly. By default,&nbsp;<code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;maps a URL to a filesystem path. However, it can also be used to redirect one URL to another URL, or to invoke an internal proxy fetch.</p>
<p><code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;provides a flexible and powerful way to manipulate URLs using an unlimited number of rules. Each rule can have an unlimited number of attached rule conditions, to allow you to rewrite URL based on server variables, environment variables, HTTP headers, or time stamps.</p>
<p><code><a href="https://httpd.apache.org/docs/2.4/mod/mod_rewrite.html">mod_rewrite</a></code>&nbsp;operates on the full URL path, including the path-info section. A rewrite rule can be invoked in&nbsp;<code>httpd.conf</code>&nbsp;or in&nbsp;<code>.htaccess</code>. The path generated by a rewrite rule can include a query string, or can lead to internal sub-processing, external request redirection, or internal proxy throughput.</p>
<p>Further details, discussion, and examples, are provided in the&nbsp;<a href="https://httpd.apache.org/docs/2.4/rewrite/">detailed mod_rewrite documentation</a>.</p>
<p>&nbsp;</p>
<ul>
<li>sudo a2enmod rewrite</li>
</ul>
<ul>
<li>sudo systemctl restart apache2</li>
</ul>
<ul>
<li>sudo nano /etc/apache2/sites-available/000-default.conf</li>
</ul>
<p>Write this</p>
<div title="/etc/apache2/sites-available/000-default.conf">/etc/apache2/sites-available/000-default.conf</div>
<div>
<div>
<pre><code><span>&lt;</span>VirtualHost *:8<span><span>0</span>&gt;</span>
    <span></span><span><span>&lt;</span>Directory /var/www/html<span>&gt;</span></span><span></span>
        <span>Options Indexes FollowSymLinks MultiViews</span>
        <span>AllowOverride All</span>
        <span>Require all granted</span>
    <span></span><span><span>&lt;</span>/Directory<span>&gt;</span></span><span></span>

    <span>.</span> <span>.</span> <span>.</span>
<span>&lt;</span>/VirtualHost<span>&gt;</span></code></pre>
</div>
</div><p>Address of the bookmark: <a href="https://www.digitalocean.com/community/tutorials/how-to-rewrite-urls-with-mod_rewrite-for-apache-on-ubuntu-18-04" rel="nofollow">https://www.digitalocean.com/community/tutorials/how-to-rewrite-urls-with-mod_rewrite-for-apache-on-ubuntu-18-04</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44403/programming-for-lovers</guid>
	<pubDate>Tue, 07 Nov 2023 23:56:30 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44403/programming-for-lovers</link>
	<title><![CDATA[Programming for Lovers !]]></title>
	<description><![CDATA[<p>Programming for Lovers (P4❤️) is a free online course that teaches programming using the Go programming language by immersing learners in fun scientific applications.</p>
<p>Each chapter focuses on a single scientific problem and contains a core text accompanied by code alongs and autograded exercises.</p>
<p>You can meet Phillip Compeau in our intro video. Phillip has taught programming at Carnegie Mellon University for years and is a serial online education founder. He is thrilled to bring you this course.</p><p>Address of the bookmark: <a href="https://programmingforlovers.com/" rel="nofollow">https://programmingforlovers.com/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43042/bioinformatics-in-thailand</guid>
	<pubDate>Wed, 28 Apr 2021 02:04:56 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43042/bioinformatics-in-thailand</link>
	<title><![CDATA[Bioinformatics in Thailand !]]></title>
	<description><![CDATA[<p>Our international PhD and master programs are designed for students who desire focused training in the elements of biology, computer science, and information technology needed for a successful career in the exciting new discipline of Bioinformatics &amp; Systems Biology. Students in our program will receive comprehensive training in omics analysis, database design and management, software engineering and programming (including web-based development), simulation techniques and modeling, and data integration. Each student will apply their skills to a practical project, where they will design and implement a solution to a real-world problem under the guidance of an experienced mentor in industry or academia.</p>
<p><strong>https://bioinformatics.kmutt.ac.th/about.html</strong></p>
<p>Duangrudee Tanramluk (Ajarn Wi) uses computational biology and machine learning to tackle the key to drug design problems via MANORAA webserver.</p>
<p><strong>https://mb.mahidol.ac.th/en/bioinformatics/</strong></p>
<p><strong>https://graduate.mahidol.ac.th/inter/</strong></p>
<p>This&nbsp;international&nbsp;Doctorate programme is designed to further broaden students&rsquo; knowledge in Bioinformatics and Molecular Biology to their maximum capability.&nbsp;</p>
<p><strong>http://www.mbb.psu.ac.th/programmes/phd</strong></p>
<p>Ph.D. program in Bioinformatics and Computational Biology is a joint effort of the Faculty of Science and Faculty of Medicine, Chulalongkorn University. The program has study plans for both applicants who hold a bachelor&rsquo;s degree and applicants who hold a master&rsquo;s degree in any related fields of study.</p>
<p><strong>http://www.bioinfo.sc.chula.ac.th/ph-d-program-specialization/</strong></p>
<p>Additional detail&nbsp;</p>
<p><strong>https://www.biotec.or.th/en/index.php/research/research-units/genome-technology-research-unit</strong></p>
<p><strong>https://tbrcnetwork.org/labtbrc/index.php/bioinformatics-and-chemoinformatics/</strong></p>
<p><strong>https://genomicsthailand.com/Genomic/home</strong></p><p>Address of the bookmark: <a href="https://bioinformatics.kmutt.ac.th/" rel="nofollow">https://bioinformatics.kmutt.ac.th/</a></p>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>

</channel>
</rss>