The vital metaphase stage of cell division, when the sister chromatids migrated to the centre and lined up in a row, and pulled apart using attached microtubules in such a way that half the DNA ends up in each daughter cell. However, before the mitotic spindle‐mediated movement gets start and pulled DNA apart, the chromosomes are free to undergo recombination which involves the exchange of genetic material either between multiple chromosomes or between different regions of the same chromosome.

During recombination, the precise breakage of each strand, exchange between the strands, and sealing of the resulting recombined molecules happens. The “chromosomal breakpoints” refers to these places where they break. Mostly, this process occurs with a high degree of accuracy at high frequency in both eukaryotic and prokaryotic cells. But occasionally this “break and sealing/ break and reattach” process goes wrong and the reattachment happens in the wrong place which usually create disaster (with few exceptions).These chromosome disaster or abnormalities involve the gain, loss or rearrangement of visible amounts of genetic material during cell division. These abnormalities are of two type, the first one is numerical abnormalities  where severe disorders are caused by the loss or gain of whole chromosomes, which affect the copy number of hundreds or even thousands of genes. The second are structural abnormalities which can be unbalanced or balanced. The former are similar to numerical abnormalities in that genetic material is either gained or lost. The natural defects in chromosome segregation are linked to cancer and several genetic diseases (http://en.wikipedia.org/wiki/List_of_genetic_disorders). Therefore, the enzymes involved in regulating cell division are still the attractive drug targets for many diseases.

Apart from certain chromosome abnormalities, these “crossing over” of segments of maternal and paternal chromosomes to form hybrid chromosomes have some evolutionary importance and considered as a driver of genetic variation. Moreover, the chromosome breakage in evolution is considered to be non-random in nature(http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.0020014). In addition the study of breakpoint regions and non-breakpoint (stable) regions of chromosomes indicates both the regions evolved in distinctly different ways ( http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2675965/). These breakage may lead to genetic diseases or participate to chromosomal rearranmgnets and contributed in development of new species.

I will try to explain the genome hotspots/Evolutionary Breakpoint Regions(EBRs)/fragile regions/weak fragments/  in my next blog.

Software for recombination detection:

RAT http://cbr.jic.ac.uk/dicks/software/RAT/

Breakpointer https://github.com/ruping/Breakpointer

DRP http://web.cbio.uct.ac.za/~darren/rdp.html

RB-finder http://www.ncbi.nlm.nih.gov/pubmed/18707535

LDhat2.0 http://ldhat.sourceforge.net/LDhat2.0/instructions.shtml

Reference:

http://www.nature.com/scitable/topicpage/genetic-recombination-514#

Image: Wikipedia , sciencelearn.org.nz

Recommended Articles:

http://www.friendshipcircle.org/blog/2012/05/22/13-chromosomal-disorders-youve-never-heard-of/

http://web.udl.es/usuaris/e4650869/docencia/segoncicle/genclin98/recursos_classe_%28pdf%29/revisionsPDF/chromosyndromes.pdf

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2775595/table/T2/

http://learn.genetics.utah.edu/content/disorders/chromosomal/

http://www.ncert.nic.in/html/learning_basket/biology/cc&cd.pdf

ftp://ftp.ncbi.nih.gov/genomes/

https://hgdownload.soe.ucsc.edu/downloads.html

Address of the bookmark: ftp://ftp.ncbi.nih.gov/genomes/

Address of the bookmark: http://www.vital-it.ch/

We work in a highly interdisciplinary environment at the interface of Computer Science and Biology. Since its inception, our lab has eagerly engaged in collaborative research partnerships with biological and experimental collaborators, facilitated by our affiliation with the Broad Institute and the Computational and Systems Biology initiative (CSBi) at MIT, our participation in the Epigenome Roadmap, ENCODE, and modENCODE consortia, and by several other ongoing collaborations at MIT, Harvard, and the Harvard Medical School affiliated hospitals.

http://compbio.mit.edu/

There are two options to run ShRec3D (on linuX only so far): the first one uses the Matlab complier runtime environment (MCR), the second one doesn't need any other library to be installed but only works with the latest versions of Linux (equivalent to Fedora 19 and above).

Address of the bookmark: https://sites.google.com/site/julienmozziconacci/#TOC-Downloads

To address the challenges of describing and estimating virodiversity, a team of investigators from Center for Infection and Immunity (CII) and EcoHealth Alliance began in jungles of Bangladesh - home to the flying fox.

Reference:

http://economictimes.indiatimes.com/news/news-by-industry/et-cetera/mammals-harbour-at-least-320000-new-viruses/articleshow/22253268.cms

http://www.bbc.co.uk/news/science-environment-23932400

Further information about LACHESIS, including source code, documentation and a user's guide are available at: http://shendurelab.github.io/LACHESIS.

Manuscript describing LACHESIS was published as: Burton JN#, Adey A, Patwardhan RP, Qiu R, Kitzman JO, Shendure J#. Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions. Nature Biotechnology 2013 Dec;31(12):1119-25. doi: 10.1038/nbt.272. PubMed PMID: 24185095.

http://shendurelab.github.io/LACHESIS/

Address of the bookmark: http://shendurelab.github.io/LACHESIS/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

It was first developed to transfer annotations between different genome assembly versions. However, it can also transfer annotations between strains and even different species, like Plasmodium chabaudi onto P. berghei, between different Leishmania species or Salmonella enterica onto other Salmonella serotypes. RATT is able to transfer any entries present on a reference sequence, such as the systematic id or an annotator's notes; such information would be lost in a de novo annotation.

More at http://ratt.sourceforge.net/

Address of the bookmark: http://ratt.sourceforge.net/

This book is suitable for classroom use as a general introduction to programming concepts.

More at http://tldp.org/LDP/abs/html/

Address of the bookmark: http://tldp.org/LDP/abs/html/