<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44713?offset=0</link>
	<atom:link href="https://bioinformaticsonline.com/related/44713?offset=0" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/21150/webinar-on-an-integrated-rna-and-dna-approach-to-unravel-genetic-regulation-in-cancer</guid>
	<pubDate>Wed, 11 Feb 2015 04:59:57 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/21150/webinar-on-an-integrated-rna-and-dna-approach-to-unravel-genetic-regulation-in-cancer</link>
	<title><![CDATA[Webinar on 'An integrated RNA and DNA approach to unravel genetic regulation in cancer']]></title>
	<description><![CDATA[<div><p><strong>Webinar on 'An integrated RNA and DNA approach to unravel genetic regulation in cancer'</strong></p><p><strong>Abstract</strong></p><p>Whole exome DNA sequencing (WES) or whole genome DNA sequencing (WGS) allows detection of mutations and polymorphisms in all exonic and genomic regions, respectively, while messenger RNA sequencing (RNA-Seq) enables quantitative analysis of gene expression. Mutations in the genome result in diverse transcriptional aberrations that can be missed in a stand-alone WES/WGS analysis. An integration of DNA variant analysis and RNA-Seq analysis enables one to investigate the consequences of genomic changes in the RNA transcripts including germline and somatic changes, imprinting, RNA editing and allele specific expression (ASE). In this webinar, we will demonstrate this integrated approach using Strand NGS to identify high confidence mutations, RNA editing events and ASE in cancer.</p><p><strong>Webinar Details</strong></p><table width="100%" border="1" cellspacing="0" cellpadding="0">
<tbody>
<tr>
<td valign="top">
<p style="text-align: center;"><br /> <strong>Sessions</strong></p>
</td>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>San Francisco Time<br /> (PST)</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Tokyo Time<br /> (GMT+09:00)</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Berlin Time<br /> (GMT+01:00)</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Mumbai Time<br /> (GMT+05:30)</strong></a></p>
</td>
</tr>
<tr>
<td>
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Session 1</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;">25 Feb&nbsp;<br /> 12:30 AM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 5:30 PM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 9:30 AM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 2:00 PM</p>
</td>
</tr>
<tr>
<td valign="top">
<p style="text-align: center;"><a href="http://www.strand-ngs.com/webinar_registration"><strong>Session 2</strong></a></p>
</td>
<td valign="top">
<p style="text-align: center;">25 Feb&nbsp;<br /> 9:00 AM</p>
</td>
<td>
<p style="text-align: center;">26 Feb<br /> 2:00 AM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 6:00 PM</p>
</td>
<td>
<p style="text-align: center;">25 Feb&nbsp;<br /> 10:30 PM</p>
</td>
</tr>
</tbody>
</table><p><strong style="font-size: 12.8000001907349px;">Register here: </strong><a href="http://www.strand-ngs.com/webinar_registration">http://www.strand-ngs.com/webinar_registration</a></p><p><strong>About Speaker:</strong></p><p>Dr. Veena Hedatale, has a PhD in Plant Genetics from The Radboud University, Netherlands focused on meiosis and recombination. Her prior academic experience at Cornell University was on genetic mapping and gene transformation in Rice. She has worked with Monsanto, and contributed to data mining, database development as well as gene/promoter/pathway discovery for traits related to yield and stress in crop species. At Strand, Veena has worked on Pharmacogenomic analysis of targets and Gene family analysis projects. Currently, she is part of the Strand NGS Application Science team and is involved in the analysis of next generation sequencing data.</p><p>Please feel free to contact us 24/5, for availing free online training or if you have any questions.</p></div><div><p><strong style="font-size: 12.8000001907349px;">Email:</strong> sales@strandngs.com</p><p><strong>Phone (USA):</strong> 1-800-752-9122</p><p><strong>Phone (ROW):</strong> +1-650-353-5060</p><p>&nbsp;</p></div>]]></description>
	<dc:creator>Yeshodari</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/19648/mit-computational-biology-group</guid>
  <pubDate>Thu, 18 Dec 2014 14:47:01 -0600</pubDate>
  <link></link>
  <title><![CDATA[MIT Computational Biology Group]]></title>
  <description><![CDATA[
<p>My research group consists primarily of computer science graduate students and postdocs with expertise in algorithms, statistical inferences and machine learning, and sharing a passion for understanding fundamental biological problems.</p>

<p>We work in a highly interdisciplinary environment at the interface of Computer Science and Biology. Since its inception, our lab has eagerly engaged in collaborative research partnerships with biological and experimental collaborators, facilitated by our affiliation with the Broad Institute and the Computational and Systems Biology initiative (CSBi) at MIT, our participation in the Epigenome Roadmap, ENCODE, and modENCODE consortia, and by several other ongoing collaborations at MIT, Harvard, and the Harvard Medical School affiliated hospitals.</p>

<p>http://compbio.mit.edu/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34477/computational-genomics-applied-comparative-genomics</guid>
	<pubDate>Wed, 29 Nov 2017 05:11:30 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34477/computational-genomics-applied-comparative-genomics</link>
	<title><![CDATA[Computational Genomics: Applied Comparative Genomics]]></title>
	<description><![CDATA[<p><span>The primary goal of the course is for students to be grounded in theory and leave the course empowered to conduct independent genomic analyses.</span><span>&nbsp;We will study the leading computational and quantitative approaches for comparing and analyzing genomes starting from raw sequencing data. The course will focus on human genomics and human medical applications, but the techniques will be broadly applicable across the tree of life. The topics will include genome assembly &amp; comparative genomics, variant identification &amp; analysis, gene expression &amp; regulation, personal genome analysis, and cancer genomics. The grading will be based on assignments, a midterm exam, class presentations, and a significant class project. There are no formal course prerequisites, although the course will require familiarity with UNIX scripting and/or programming to complete the assignments and course project.</span></p><p>Address of the bookmark: <a href="https://github.com/schatzlab/appliedgenomics" rel="nofollow">https://github.com/schatzlab/appliedgenomics</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/17843/pathway-analysis</guid>
	<pubDate>Fri, 03 Oct 2014 08:51:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/17843/pathway-analysis</link>
	<title><![CDATA[Pathway Analysis]]></title>
	<description><![CDATA[<p>Pathway Analysis is usually performed with aim to enrich the genes with their functional information and reveal the underlying biological mechanisms pursue by genes. Pathway Analysis is not only limited to what biological pathways a particular set of expressed genes follow but also to disclose the relationships between these genes. With availability of more genomics, transcriptomics and proteomics data, interactions between genes involve in multiple pathways become more clear and also relationships between the genes, their transcripts, and their gene products. However, existing tools and dbs mainly based on knowledge driven approach in which pathways will be identified by finding the correlation between the&nbsp;<span>information in one of the pathway knowledge databases (KEGG,Reactome,Panther,BioCarta, Panther,GO,NCI,WikiPathways,etc) and gene expression result for a specific conditions for instance tumor, obesity , cold resistant crops/plants, etc.</span></p><p><span><strong>Introductory Articles/ppt/sources</strong>:</span></p><p><a href="http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1002375"><span>http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1002375</span></a></p><p><a href="http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf"><span>http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf</span></a></p><p><a href="http://gettinggeneticsdone.blogspot.de/2012/03/pathway-analysis-for-high-throughput.html"><span>http://gettinggeneticsdone.blogspot.de/2012/03/pathway-analysis-for-high-throughput.html</span></a></p><p><a href="http://davetang.org/muse/tag/pathway/"><span>http://davetang.org/muse/tag/pathway/</span></a></p><p><a href="https://www.biostars.org/p/42219/"><span>https://www.biostars.org/p/42219/</span></a></p><p><a href="http://bioinformatics.ca//files/public/Pathways_2014_Module4_v2.pdf"><span>http://bioinformatics.ca//files/public/Pathways_2014_Module4_v2.pdf</span></a></p><p><a href="http://bioinformatics.ca//files/public/Pathways_2014_Module2.pdf"><span>http://bioinformatics.ca//files/public/Pathways_2014_Module2.pdf</span></a></p><p><span><strong>Impotant Database and Tools</strong>:</span></p><p>GeneMANIA, Cytoscape,&nbsp;<a href="http://www.ingenuity.com/products/ipa">IPA</a>&nbsp;and <a href="http://thomsonreuters.com/metacore/">Metacore</a> (Commerical ),&nbsp;<span>Pathway Commons, Reactome ,Panther, BioCyc, WikiPathways, Pathvisio, KEGG, NCI, Stringdb, Amigo,&nbsp;<span>WebGestalt ,<span>ConsensusPathDB ,GSEA,Blast2go</span></span></span></p><p><span><strong>Popular R based tools</strong>:</span></p><p><span>Reactome.db, ReactomePA, ClusterProfiler, Gage, SPIA, topGO, Pathview,DOSE,GOStat</span></p><p><span><strong>More</strong>:</span></p><p><a href="http://www.bioconductor.org/help/search/index.html?q=Enrichment+analysis+"><span>http://www.bioconductor.org/help/search/index.html?q=Enrichment+analysis+</span></a></p><p>&nbsp;</p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44716/exploring-rna-sequence-analysis-tools-for-every-bioinformatician</guid>
	<pubDate>Fri, 13 Dec 2024 04:03:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44716/exploring-rna-sequence-analysis-tools-for-every-bioinformatician</link>
	<title><![CDATA[Exploring RNA Sequence Analysis: Tools for Every Bioinformatician]]></title>
	<description><![CDATA[<p>RNA sequence analysis has become an essential part of modern biological research. From RNA-seq pipelines to specialized tools for specific RNA types, here's a comprehensive guide to tools you can use to make sense of RNA data.</p><h4><strong>1. RNA-Seq Analysis Pipelines</strong></h4><p>RNA-seq is one of the most popular techniques for studying RNA. These tools streamline processing raw sequence data:</p><ul>
<li><strong>FASTQC</strong>: For quality control of raw RNA-seq reads.</li>
<li><strong>Trimmomatic</strong>: For trimming and filtering RNA-seq reads.</li>
<li><strong>HISAT2/STAR</strong>: High-performance aligners for RNA-seq reads.</li>
<li><strong>FeatureCounts</strong>: For quantifying gene expression.</li>
<li><strong>DESeq2/EdgeR</strong>: For differential expression analysis.</li>
</ul><h4><strong>2. Transcriptome Assembly and Annotation</strong></h4><p>For analyzing transcriptomes from non-model organisms or assembling novel transcripts:</p><ul>
<li><strong>Trinity</strong>: For de novo transcriptome assembly.</li>
<li><strong>StringTie</strong>: For transcript assembly and quantification from RNA-seq alignments.</li>
<li><strong>TransDecoder</strong>: To predict coding regions within assembled transcripts.</li>
<li><strong>TAU</strong>: Tools for annotating non-coding and coding RNAs.</li>
</ul><h4><strong>3. Exploring Non-Coding RNA (ncRNA)</strong></h4><p>Non-coding RNAs play critical regulatory roles. Dedicated tools for studying them include:</p><ul>
<li><strong>Infernal</strong>: For identifying ncRNA sequences based on covariance models.</li>
<li><strong>Rfam</strong>: Database and tools for ncRNA families.</li>
<li><strong>miRDeep</strong>: For identifying microRNAs in RNA-seq datasets.</li>
</ul><h4><strong>4. RNA Structure and Motif Analysis</strong></h4><p>Structural biology of RNA helps in understanding its function:</p><ul>
<li><strong>RNAfold (ViennaRNA)</strong>: Predicts secondary structures from RNA sequences.</li>
<li><strong>RNAstructure</strong>: Tools for RNA secondary structure prediction and analysis.</li>
<li><strong>MEME Suite</strong>: For identifying motifs in RNA sequences.</li>
<li><strong>IntaRNA</strong>: For RNA-RNA interaction prediction.</li>
</ul><h4><strong>5. RNA Editing and Modifications</strong></h4><p>Epitranscriptomics is a growing field focusing on RNA modifications:</p><ul>
<li><strong>REDItools</strong>: For RNA editing analysis.</li>
<li><strong>m6Aboost</strong>: For identifying m6A modifications in RNA.</li>
</ul><h4><strong>6. Long-Read RNA Sequencing Analysis</strong></h4><p>Long-read technologies like Nanopore and PacBio are transforming RNA research:</p><ul>
<li><strong>FLAIR</strong>: For isoform-level analysis of long-read RNA-seq data.</li>
<li><strong>NanoMod</strong>: For detecting modifications in RNA from Nanopore sequencing.</li>
</ul><h4><strong>7. RNA-Protein Interactions</strong></h4><p>To study RNA-protein interactions and complexes:</p><ul>
<li><strong>RBPmap</strong>: For identifying RNA-binding protein motifs.</li>
<li><strong>PARalyzer</strong>: For analyzing PAR-CLIP data.</li>
</ul><h4><strong>8. Functional Enrichment Analysis</strong></h4><p>Understanding biological functions and pathways from RNA-seq data:</p><ul>
<li><strong>getENRICH</strong>: A tool designed for pathway enrichment analysis of non-model organisms (hypergeometric P-value calculation with FDR correction).</li>
<li><strong>ClusterProfiler</strong>: For GO and KEGG pathway enrichment analysis.</li>
</ul><h4><strong>9. Visualization and Data Sharing</strong></h4><p>Presenting and sharing RNA sequence analysis results effectively:</p><ul>
<li><strong>IGV</strong>: Genome browser for visualizing RNA-seq alignments.</li>
<li><strong>Circos</strong>: Circular visualization of RNA-seq data.</li>
<li><strong>DashBio</strong>: A Python library for creating bioinformatics visualizations.</li>
</ul><h4><strong>Conclusion</strong></h4><p>The bioinformatics landscape for RNA sequence analysis is vast, with tools catering to specific needs. Whether you&rsquo;re studying coding RNAs, non-coding RNAs, or exploring RNA-protein interactions, the right tools can transform your data into biological insights.</p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/7214/lapti-lab</guid>
  <pubDate>Thu, 12 Dec 2013 18:19:12 -0600</pubDate>
  <link></link>
  <title><![CDATA[LAPTI Lab]]></title>
  <description><![CDATA[
<p>The main theme of our research is the understanding of how genetic information is decoded from DNA into RNA and proteins. Someone may find this topic a little strange and argue that we already know how this is happening.</p>

<p>Translational recoding. </p>

<p>RNA editing. </p>

<p>Evolution of the genetic code and translation.</p>

<p>More at http://lapti.ucc.ie/research.html</p>

<p>Lab page http://lapti.ucc.ie/index.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/18738/surrogate-variable-analysis-sva</guid>
	<pubDate>Thu, 30 Oct 2014 08:01:58 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/18738/surrogate-variable-analysis-sva</link>
	<title><![CDATA[Surrogate Variable Analysis (SVA)]]></title>
	<description><![CDATA[<p>The sva package contains functions for removing batch effects and other unwanted variation in high-throughput experiment. Specifically, the sva package contains functions for the identifying and building surrogate variables for high-dimensional data sets. Surrogate variables are covariates constructed directly from high-dimensional data (like gene expression/RNA sequencing/methylation/brain imaging data) that can be used in subsequent analyses to adjust for unknown, unmodeled, or latent sources of noise. The sva package can be used to remove artifacts in three ways:</p><p>(1) identifying and estimating surrogate variables for unknown sources of variation in high-throughput experiments (Leek and Storey 2007 PLoS Genetics,2008 PNAS),</p><p>(2) directly removing known batch effects using ComBat (Johnson et al. 2007 Biostatistics) and</p><p>(3) removing batch effects with known control probes (Leek 2014 biorXiv).</p><p>Removing batch effects and using surrogate variables in differential expression analysis have been shown to reduce dependence, stabilize error rate estimates, and improve reproducibility, see (Leek and Storey 2007 PLoS Genetics, 2008 PNAS or Leek et al. 2011 Nat. Reviews Genetics).</p><p>More at http://www.bioconductor.org/packages/release/bioc/html/sva.html</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/22891/17-marie-curie-phd-position-available-immediately</guid>
  <pubDate>Tue, 23 Jun 2015 06:52:06 -0500</pubDate>
  <link></link>
  <title><![CDATA[17 Marie Curie PhD position available immediately]]></title>
  <description><![CDATA[
<p>Kindly look into following webpage:<br />http://medhealth.leeds.ac.uk/info/1450/scholarships/1795/marie_curie_phd_training_network</p>

<p>The closing date for application will be 26 June 2015.</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41394/ngsymposium-in-computational-biology</guid>
  <pubDate>Mon, 09 Mar 2020 06:00:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[NGSymposium in Computational Biology]]></title>
  <description><![CDATA[
<p>We have a great pleasure to invite you to the NGSymposium in Computational Biology to celebrate the 5th anniversary of the NGSchool Summer Schools. This international conference will make way for exchanging knowledge and experiences between experienced and early-stage researchers as well as bioinformaticians. The meeting will be held on 31.07 - 1.08.2020 in Warsaw. It will be a satellite event to the #NGSchool2020: Statistical Learning in Genomics. It will cover a wide range of topics from basic and applied biomedical sciences: bioinformatics, genomics, transcriptomics, computational biology, Machine Learning.</p>

<p>Registration of active participants will be open from February, 27 12 PM CET to April 17, 23:59 CET. In registration forms you will be asked for providing us with some basic information about yourself. You will also be able to submit your abstract. You can save your registration form after filling it partially and come back later to supply more data e.g. upload an abstract. Your registration will be completed only with the payment of the registration fee reaching our accounts - please make sure to transfer the money in advance!</p>

<p>Registration of passive participants will be open after closing of registration of active participants.</p>

<p>Details an registration: https://ngschool.eu/conference/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>

</channel>
</rss>