Webinar on 'An integrated RNA and DNA approach to unravel genetic regulation in cancer'

Abstract

Whole exome DNA sequencing (WES) or whole genome DNA sequencing (WGS) allows detection of mutations and polymorphisms in all exonic and genomic regions, respectively, while messenger RNA sequencing (RNA-Seq) enables quantitative analysis of gene expression. Mutations in the genome result in diverse transcriptional aberrations that can be missed in a stand-alone WES/WGS analysis. An integration of DNA variant analysis and RNA-Seq analysis enables one to investigate the consequences of genomic changes in the RNA transcripts including germline and somatic changes, imprinting, RNA editing and allele specific expression (ASE). In this webinar, we will demonstrate this integrated approach using Strand NGS to identify high confidence mutations, RNA editing events and ASE in cancer.

Webinar Details

Register here: http://www.strand-ngs.com/webinar_registration

About Speaker:

Dr. Veena Hedatale, has a PhD in Plant Genetics from The Radboud University, Netherlands focused on meiosis and recombination. Her prior academic experience at Cornell University was on genetic mapping and gene transformation in Rice. She has worked with Monsanto, and contributed to data mining, database development as well as gene/promoter/pathway discovery for traits related to yield and stress in crop species. At Strand, Veena has worked on Pharmacogenomic analysis of targets and Gene family analysis projects. Currently, she is part of the Strand NGS Application Science team and is involved in the analysis of next generation sequencing data.

Please feel free to contact us 24/5, for availing free online training or if you have any questions.

We work in a highly interdisciplinary environment at the interface of Computer Science and Biology. Since its inception, our lab has eagerly engaged in collaborative research partnerships with biological and experimental collaborators, facilitated by our affiliation with the Broad Institute and the Computational and Systems Biology initiative (CSBi) at MIT, our participation in the Epigenome Roadmap, ENCODE, and modENCODE consortia, and by several other ongoing collaborations at MIT, Harvard, and the Harvard Medical School affiliated hospitals.

http://compbio.mit.edu/

Address of the bookmark: https://github.com/schatzlab/appliedgenomics

Introductory Articles/ppt/sources:

http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1002375

http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf

http://gettinggeneticsdone.blogspot.de/2012/03/pathway-analysis-for-high-throughput.html

http://davetang.org/muse/tag/pathway/

https://www.biostars.org/p/42219/

http://bioinformatics.ca//files/public/Pathways_2014_Module4_v2.pdf

http://bioinformatics.ca//files/public/Pathways_2014_Module2.pdf

Impotant Database and Tools:

GeneMANIA, Cytoscape, IPA and Metacore (Commerical ), Pathway Commons, Reactome ,Panther, BioCyc, WikiPathways, Pathvisio, KEGG, NCI, Stringdb, Amigo, WebGestalt ,ConsensusPathDB ,GSEA,Blast2go

Popular R based tools:

Reactome.db, ReactomePA, ClusterProfiler, Gage, SPIA, topGO, Pathview,DOSE,GOStat

More:

http://www.bioconductor.org/help/search/index.html?q=Enrichment+analysis+

1. RNA-Seq Analysis Pipelines

RNA-seq is one of the most popular techniques for studying RNA. These tools streamline processing raw sequence data:

• FASTQC: For quality control of raw RNA-seq reads.
• Trimmomatic: For trimming and filtering RNA-seq reads.
• HISAT2/STAR: High-performance aligners for RNA-seq reads.
• FeatureCounts: For quantifying gene expression.
• DESeq2/EdgeR: For differential expression analysis.

2. Transcriptome Assembly and Annotation

For analyzing transcriptomes from non-model organisms or assembling novel transcripts:

• Trinity: For de novo transcriptome assembly.
• StringTie: For transcript assembly and quantification from RNA-seq alignments.
• TransDecoder: To predict coding regions within assembled transcripts.
• TAU: Tools for annotating non-coding and coding RNAs.

3. Exploring Non-Coding RNA (ncRNA)

Non-coding RNAs play critical regulatory roles. Dedicated tools for studying them include:

• Infernal: For identifying ncRNA sequences based on covariance models.
• Rfam: Database and tools for ncRNA families.
• miRDeep: For identifying microRNAs in RNA-seq datasets.

4. RNA Structure and Motif Analysis

Structural biology of RNA helps in understanding its function:

• RNAfold (ViennaRNA): Predicts secondary structures from RNA sequences.
• RNAstructure: Tools for RNA secondary structure prediction and analysis.
• MEME Suite: For identifying motifs in RNA sequences.
• IntaRNA: For RNA-RNA interaction prediction.

5. RNA Editing and Modifications

Epitranscriptomics is a growing field focusing on RNA modifications:

• REDItools: For RNA editing analysis.
• m6Aboost: For identifying m6A modifications in RNA.

6. Long-Read RNA Sequencing Analysis

Long-read technologies like Nanopore and PacBio are transforming RNA research:

• FLAIR: For isoform-level analysis of long-read RNA-seq data.
• NanoMod: For detecting modifications in RNA from Nanopore sequencing.

7. RNA-Protein Interactions

To study RNA-protein interactions and complexes:

• RBPmap: For identifying RNA-binding protein motifs.
• PARalyzer: For analyzing PAR-CLIP data.

8. Functional Enrichment Analysis

Understanding biological functions and pathways from RNA-seq data:

• getENRICH: A tool designed for pathway enrichment analysis of non-model organisms (hypergeometric P-value calculation with FDR correction).
• ClusterProfiler: For GO and KEGG pathway enrichment analysis.

9. Visualization and Data Sharing

Presenting and sharing RNA sequence analysis results effectively:

• IGV: Genome browser for visualizing RNA-seq alignments.
• Circos: Circular visualization of RNA-seq data.
• DashBio: A Python library for creating bioinformatics visualizations.

Conclusion

The bioinformatics landscape for RNA sequence analysis is vast, with tools catering to specific needs. Whether you’re studying coding RNAs, non-coding RNAs, or exploring RNA-protein interactions, the right tools can transform your data into biological insights.

Translational recoding.

RNA editing.

Evolution of the genetic code and translation.

More at http://lapti.ucc.ie/research.html

Lab page http://lapti.ucc.ie/index.html

(1) identifying and estimating surrogate variables for unknown sources of variation in high-throughput experiments (Leek and Storey 2007 PLoS Genetics,2008 PNAS),

(2) directly removing known batch effects using ComBat (Johnson et al. 2007 Biostatistics) and

(3) removing batch effects with known control probes (Leek 2014 biorXiv).

Removing batch effects and using surrogate variables in differential expression analysis have been shown to reduce dependence, stabilize error rate estimates, and improve reproducibility, see (Leek and Storey 2007 PLoS Genetics, 2008 PNAS or Leek et al. 2011 Nat. Reviews Genetics).

More at http://www.bioconductor.org/packages/release/bioc/html/sva.html

The closing date for application will be 26 June 2015.

Registration of active participants will be open from February, 27 12 PM CET to April 17, 23:59 CET. In registration forms you will be asked for providing us with some basic information about yourself. You will also be able to submit your abstract. You can save your registration form after filling it partially and come back later to supply more data e.g. upload an abstract. Your registration will be completed only with the payment of the registration fee reaching our accounts - please make sure to transfer the money in advance!

Registration of passive participants will be open after closing of registration of active participants.

Details an registration: https://ngschool.eu/conference/

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.