<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44716?offset=1250</link>
	<atom:link href="https://bioinformaticsonline.com/related/44716?offset=1250" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/11144/scientists-map-17294-proteins-produced-in-human-body</guid>
	<pubDate>Thu, 29 May 2014 01:57:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/11144/scientists-map-17294-proteins-produced-in-human-body</link>
	<title><![CDATA[Scientists map 17,294 proteins produced in human body]]></title>
	<description><![CDATA[<p>Indian scientists missed the genomic profiling bus, but they've more than made up for it by creating the first human proteome map which is an extension of the genomic study. Till now, here is no direct equivalent for the human proteome. But recently two groups present mass spectrometry-based analysis of human tissues, body fluids and cells mapping the large majority of the human proteome.</p><p>The Indian scientists working in Bangalore, along with their American counterparts, have mapped more than 17,000 proteins in 30 organs of the human body. Just like the human genome was sequenced around the turn of the millennium, this is an equivalent mapping of the human proteome.<br /><br />The researcher estimated there are around 20,500 proteins in the human body. These scientists have profiled around 17,294, which account for around 84% of the total proteins. Apart from this, the team also traced around 2,500 of 3,000 proteins that had been categorised as "missing proteins".</p><p>The work, done by group of Indian scientists, and Johns Hopkins University, published in the renowned journal Nature ( http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html ). Of the 72 people who worked on the project, 46 are Indians.</p><p>Reference:</p><p>http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html</p><p>http://www.proteinatlas.org/ -The antibody-based Human Protein Atlas programme</p><p>http://www.humanproteomemap.org/ -Proteogenomic analysis by identifying translated proteins from annotated pseudogenes, non-coding RNAs and untranslated regions.</p><p>https://www.proteomicsdb.org/ -Assembled protein evidence for 18,097 genes in ProteomicsDB</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</guid>
	<pubDate>Fri, 30 May 2014 13:24:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</link>
	<title><![CDATA[How to sequence the human genome - Mark J. Kiel]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/MvuYATh7Y74" frameborder="0" allowfullscreen></iframe>View full lesson: http://ed.ted.com/lessons/how-to-sequence-the-human-genome-mark-j-kiel

Your genome, every human's genome, consists of a unique DNA sequence of A's, T's, C's and G's that tell your cells how to operate. Thanks to technological advances, scientists are now able to know the sequence of letters that makes up an individual genome relatively quickly and inexpensively. Mark J. Kiel takes an in-depth look at the science behind the sequence.

Lesson by Mark J. Kiel, animation by Marc Christoforidis.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11354/genomics-and-personalized-medicine</guid>
	<pubDate>Sun, 01 Jun 2014 23:38:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11354/genomics-and-personalized-medicine</link>
	<title><![CDATA[Genomics and Personalized Medicine]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/pgHAXCMMcro" frameborder="0" allowfullscreen></iframe>(October 20, 2009) Michael Snyder, Professor of Genetics and Chair of the Department of Genetics at Stanford, discusses advances in gene sequencing, the impact of genomics on medicine, the potential for personalized medicine. and efforts at Stanford to further study these issues.

Stanford Mini Med School is a series arranged and directed by Stanford's School of Medicine, and presented by the Stanford Continuing Studies program. Featuring more than thirty distinguished, faculty, scientists and physicians from Stanford's medical school, the series offers students a dynamic introduction to the world of human biology, health and disease, and the groundbreaking changes taking place in medical research and health care.

Stanford University
http://www.stanford.edu

Stanford University School of Medicine
http://med.stanford.edu

Stanford Continuing Studies
http://continuingstudies.stanford.edu

Stanford University Channel on YouTube:
http://www.youtube.com/stanford]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/5894/rna-seq-data-pathway-and-gene-set-analysis-workflows</guid>
	<pubDate>Fri, 25 Oct 2013 08:00:48 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/5894/rna-seq-data-pathway-and-gene-set-analysis-workflows</link>
	<title><![CDATA[RNA-Seq Data Pathway and Gene-set Analysis Workflows]]></title>
	<description><![CDATA[<p>It describe the GAGE (Luo et al., 2009) /Pahview (Luo and Brouwer, 2013) workflows on&nbsp;RNA-Seq data pathway analysis and gene-set analysis.&nbsp;<span>The gage package (2.12.0) now includes a new tutorial, &ldquo;RNA-Seq Data Pathway and Gene-set Analysis Workflows&ldquo;.</span></p><p>First cover a full workflow from preparation, reads counting, data preprocessing, gene set test, to pathway visualization in about 40 lines of codes. The same workflow can be used for GO analysis or other types of gene set analysis too. We also describe joint workflows, i.e. to do gene-level analysis using one of the major RNA-Seq analysis tools, DEseq/DEseq2, edgeR, limma and Cufflinks, and feed the results into GAGE/Pahview for pathway analysis or visualization. All these workflows are implemented in R/Bioconductor.</p><p>The work ows cover the most common situations and issues for RNA-Seq data pathway analysis. Issues like&nbsp;data quality assessment are relevant for data analysis in general yet out the scope of this tutorial. Although we&nbsp;focus on RNA-Seq data here, but pathway analysis work ow remains similar for microarray, particularly step&nbsp;3-4 would be the same. Please check gage and pathview vigenttes for details.</p><p>Note: You need to update to current release versions of R(3.0.2)/ Bioconductor(2.13) to use all the features.&nbsp;</p><p>Reference:&nbsp;</p><p>Please check it out:<br /><a href="http://bioconductor.org/packages/release/bioc/html/gage.html">http://bioconductor.org/packages/release/bioc/html/gage.html</a><br /><a href="http://bioconductor.org/packages/release/bioc/vignettes/gage/inst/doc/RNA-seqWorkflow.pdf">http://bioconductor.org/packages/release/bioc/vignettes/gage/inst/doc/RNA-seqWorkflow.pdf</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11434/adhoc-bioinformatics-faculty-position-nit</guid>
  <pubDate>Tue, 03 Jun 2014 16:19:52 -0500</pubDate>
  <link></link>
  <title><![CDATA[Adhoc Bioinformatics Faculty Position @ NIT]]></title>
  <description><![CDATA[
<p>NATIONAL INSTITUTE OF TECHNOLOGY, DEPARTMENT OF BIOTECHNOLOGY, WARANGAL – 506 021, Andhra Pradesh</p>

<p>No.NITW/BT/2014/adhoc</p>

<p>APPLICATIONS ARE INVITED FOR THE APPOINTMENT OF ADHOC FACULTY ON CONTRACT BASIS IN THE DEAPARTMENT OF BIOTECHNOLOGY</p>

<p>Period of Contract: Initially the appointment is for one semester i.e., from July 2014 up to December 2014 only.</p>

<p>Essential Qualifications:</p>

<p>i) B. Tech or equivalent in Biotechnology/ Industrial Biotechnology/ Biochemical Engineering / Chemical Engg. Or M. Sc in Microbiology/ Botany/ Zoology/ Biochemistry/Biotechnology and ii) M. Tech or equivalent in Biotechnology/Industrial Biotechnology/Bioinformatics</p>

<p>Or</p>

<p>Integrated M. Tech in Biotechnology/Industrial Biotechnology/ Bioinformatics</p>

<p>Candidates must possess First class (60% aggregate marks or 6.5 CGPA) at B. Tech/ M. Sc and M. Tech.</p>

<p>Desirable: Ph. D Pay Package: All selected candidates shall be eligible for a consolidated pay of Rs.30, 000/- per month. Candidates with Ph. D shall be eligible for an additional amount of Rs.5, 000/- per month.</p>

<p>How to apply : Applications on plain paper with attested photocopies of certificate and bio data along with justification for eligibility should reach to the Head, Department of Biotechnology, National Institute of Technology, Warangal AP 506004 in the form of soft or hard copy on or before 21st June 2014 email : biotech_hod@nitw.ac.in</p>

<p>Intimation: No separate call letters will be sent to the candidates. All the eligible candidates will be notified in the institute web site on 23rd June 2014. All the eligible candidates are requested to report for the interview to the Head, Department of Biotechnology at 9:00 AM on 27th June 2014</p>

<p>Joining: Selected candidates will be informed and they are expected to join immediately.</p>

<p>Advertisement:</p>

<p>http://www.nitw.ac.in/nitw/announcements/2014/Bio-Adhoc%20Advt.%20May-2014.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37225/installing-trinity</guid>
	<pubDate>Tue, 03 Jul 2018 04:31:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37225/installing-trinity</link>
	<title><![CDATA[Installing Trinity !]]></title>
	<description><![CDATA[
<p>Download this https://github.com/trinityrnaseq/trinityrnaseq/releases/tag/Trinity-v2.6.6</p>

<p>➜ cd trinityrnaseq-Trinity-v2.6.6</p>

<p>➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ make<br />Using gnu compiler for Inchworm and Chrysalis<br />cd Inchworm &amp;&amp; (test -e configure || autoreconf) \<br />                &amp;&amp; sh ./configure --prefix=`pwd`  &amp;&amp; make install<br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking whether build environment is sane... yes<br />checking for a thread-safe mkdir -p... /bin/mkdir -p<br />checking for gawk... gawk<br />checking whether make sets $(MAKE)... yes<br />checking for g++... g++<br />checking whether the C++ compiler works... yes<br />checking for C++ compiler default output file name... a.out<br />checking for suffix of executables... <br />checking whether we are cross compiling... no<br />checking for suffix of object files... o<br />checking whether we are using the GNU C++ compiler... yes<br />checking whether g++ accepts -g... yes<br />checking for style of include used by make... GNU<br />checking dependency style of g++... gcc3<br />checking for library containing cos... none required<br />configure: creating ./config.status<br />config.status: creating Makefile<br />config.status: creating src/Makefile<br />config.status: creating config.h<br />config.status: config.h is unchanged<br />config.status: executing depfiles commands<br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />Making install in src<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_entry.o -MD -MP -MF .deps/Fasta_entry.Tpo -c -o Fasta_entry.o Fasta_entry.cpp<br />mv -f .deps/Fasta_entry.Tpo .deps/Fasta_entry.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE_run.o -MD -MP -MF .deps/IRKE_run.Tpo -c -o IRKE_run.o IRKE_run.cpp<br />mv -f .deps/IRKE_run.Tpo .deps/IRKE_run.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT sequenceUtil.o -MD -MP -MF .deps/sequenceUtil.Tpo -c -o sequenceUtil.o sequenceUtil.cpp<br />mv -f .deps/sequenceUtil.Tpo .deps/sequenceUtil.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE.o -MD -MP -MF .deps/IRKE.Tpo -c -o IRKE.o IRKE.cpp<br />mv -f .deps/IRKE.Tpo .deps/IRKE.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT KmerCounter.o -MD -MP -MF .deps/KmerCounter.Tpo -c -o KmerCounter.o KmerCounter.cpp<br />mv -f .deps/KmerCounter.Tpo .deps/KmerCounter.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT string_util.o -MD -MP -MF .deps/string_util.Tpo -c -o string_util.o string_util.cpp<br />mv -f .deps/string_util.Tpo .deps/string_util.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_reader.o -MD -MP -MF .deps/Fasta_reader.Tpo -c -o Fasta_reader.o Fasta_reader.cpp<br />mv -f .deps/Fasta_reader.Tpo .deps/Fasta_reader.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT stacktrace.o -MD -MP -MF .deps/stacktrace.Tpo -c -o stacktrace.o stacktrace.cpp<br />mv -f .deps/stacktrace.Tpo .deps/stacktrace.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp<br />mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o inchworm Fasta_entry.o IRKE_run.o sequenceUtil.o IRKE.o KmerCounter.o string_util.o Fasta_reader.o stacktrace.o argProcessor.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT cigar_tweaker.o -MD -MP -MF .deps/cigar_tweaker.Tpo -c -o cigar_tweaker.o cigar_tweaker.cpp<br />mv -f .deps/cigar_tweaker.Tpo .deps/cigar_tweaker.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_entry.o -MD -MP -MF .deps/SAM_entry.Tpo -c -o SAM_entry.o SAM_entry.cpp<br />mv -f .deps/SAM_entry.Tpo .deps/SAM_entry.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_reader.o -MD -MP -MF .deps/SAM_reader.Tpo -c -o SAM_reader.o SAM_reader.cpp<br />mv -f .deps/SAM_reader.Tpo .deps/SAM_reader.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Cigar.o -MD -MP -MF .deps/Cigar.Tpo -c -o Cigar.o Cigar.cpp<br />mv -f .deps/Cigar.Tpo .deps/Cigar.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o cigar_tweaker cigar_tweaker.o SAM_entry.o sequenceUtil.o SAM_reader.o Cigar.o string_util.o stacktrace.o Fasta_reader.o Fasta_entry.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT pull_reads_with_kmers.o -MD -MP -MF .deps/pull_reads_with_kmers.Tpo -c -o pull_reads_with_kmers.o pull_reads_with_kmers.cpp<br />mv -f .deps/pull_reads_with_kmers.Tpo .deps/pull_reads_with_kmers.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o pull_reads_with_kmers pull_reads_with_kmers.o Fasta_reader.o Fasta_entry.o sequenceUtil.o KmerCounter.o string_util.o stacktrace.o argProcessor.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT FastaToDeBruijn.o -MD -MP -MF .deps/FastaToDeBruijn.Tpo -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp<br />FastaToDeBruijn.cpp: In function ‘void createGraphPerRecord(std::vector &gt;, int, bool, ArgProcessor)’:<br />FastaToDeBruijn.cpp:199:39: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                 if (seq_region.size() &lt; kmer_length) { continue; }  // can be e<br />                                       ^<br />mv -f .deps/FastaToDeBruijn.Tpo .deps/FastaToDeBruijn.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT DeBruijnGraph.o -MD -MP -MF .deps/DeBruijnGraph.Tpo -c -o DeBruijnGraph.o DeBruijnGraph.cpp<br />mv -f .deps/DeBruijnGraph.Tpo .deps/DeBruijnGraph.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o FastaToDeBruijn FastaToDeBruijn.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o DeBruijnGraph.o  <br />g++ -DHAVE_CONFIG_H -I. -I..    -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT fastaToKmerCoverageStats.o -MD -MP -MF .deps/fastaToKmerCoverageStats.Tpo -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp<br />fastaToKmerCoverageStats.cpp: In function ‘void populate_kmer_counter_from_reads(KmerCounter&amp;, std::__cxx11::string&amp;)’:<br />fastaToKmerCoverageStats.cpp:226:18: warning: unused variable ‘kmer_length’ [-Wunused-variable]<br />     unsigned int kmer_length = kcounter.get_kmer_length();<br />                  ^<br />mv -f .deps/fastaToKmerCoverageStats.Tpo .deps/fastaToKmerCoverageStats.Po<br />g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2   -o fastaToKmerCoverageStats fastaToKmerCoverageStats.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o KmerCounter.o  <br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin"<br />  /usr/bin/install -c inchworm cigar_tweaker pull_reads_with_kmers FastaToDeBruijn fastaToKmerCoverageStats '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin'<br />make[3]: Nothing to be done for 'install-data-am'.<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[3]: Nothing to be done for 'install-exec-am'.<br />make[3]: Nothing to be done for 'install-data-am'.<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'<br />cd Chrysalis &amp;&amp; make UNSUPPORTED=yes <br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'<br />./MakeDepend.cc: In member function ‘bool makefile_builder::dependency::operator&lt;(const makefile_builder::dependency&amp;) const’:<br />./MakeDepend.cc:93:47: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />                dependent_ == other.dependent_ &amp;&amp;<br />                                               ^<br />./MakeDepend.cc: In member function ‘bool makefile_builder::subdir_and_target::operator&lt;(const makefile_builder::subdir_and_target&amp;) const’:<br />./MakeDepend.cc:130:41: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />                subdir_ == other.subdir_ &amp;&amp;<br />                                         ^<br />./MakeDepend.cc: In function ‘int main(int, char**)’:<br />./MakeDepend.cc:223:20: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]<br />   char * options = "Ad:g:u:fh";<br />                    ^<br />./MakeDepend.cc: In member function ‘void makefile_builder::DumpDependencies(const string&amp;)’:<br />./MakeDepend.cc:491:46: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />       if ( ! this-&gt;FileIsSource( dependent ) &amp;&amp; ! this-&gt;FileIsHeader( dependent<br />                                              ^<br />./MakeDepend.cc:493:44: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />            this-&gt;FileIsHeader( dependent ) &amp;&amp; this-&gt;FileIsSource( provider ) ) <br />                                            ^<br />./MakeDepend.cc: In member function ‘bool makefile_builder::FileIsHeader(const string&amp;) const’:<br />./MakeDepend.cc:1339:32: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />   return ( filename.size() &gt; 2 &amp;&amp;<br />                                ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:04 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./aligns/KmerAlignCore.cc -o obj/aligns/KmerAlignCore.o<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:06 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/AACodons.cc -o obj/analysis/AACodons.o<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:09 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/BreakTransByPairs.cc -o obj/analysis/BreakTransByPairs.o<br />./analysis/BreakTransByPairs.cc: In function ‘int main(int, char**)’:<br />./analysis/BreakTransByPairs.cc:105:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i &gt; DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’:<br />./analysis/DeBruijnGraph.cc:473:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; left_extensions.size(); i++) {<br />                       ^<br />./analysis/DeBruijnGraph.cc:476:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (int j = 0; j &lt; right_extensions.size(); j++) {<br />                           ^<br />./analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&amp;, std::vector &gt;&amp;, char, std::map&amp;, int)’:<br />./analysis/DeBruijnGraph.cc:513:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; adjacent_kmers.size(); i++) {<br />                       ^<br />./analysis/DeBruijnGraph.cc:527:41: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         if (kmer_extension_chars.size() == flank_extension_length) {<br />                                         ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:30 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/sequenceUtil.cc -o obj/analysis/sequenceUtil.o<br />./analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::__cxx11::string)’:<br />./analysis/sequenceUtil.cc:33:20: warning: array subscript has type ‘char’ [-Wchar-subscripts]<br />  if (_base_to_int[c] &gt; 3)<br />                    ^<br />./analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::__cxx11::string)’:<br />./analysis/sequenceUtil.cc:264:26: warning: array subscript has type ‘char’ [-Wchar-subscripts]<br />  int val = _base_to_int[c];<br />                          ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:31 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/stacktrace.cc -o obj/analysis/stacktrace.o<br />/bin/rm -f lib_BubbleUpClustering_temp.a<br />ar -qc  lib_BubbleUpClustering_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/BubbleUpClustering.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./BubbleUpClustering<br />g++ -ggdb3    -fopenmp  -o ./BubbleUpClustering  obj/analysis/BubbleUpClustering.o -L. -lm -pthread     -l_BubbleUpClustering_temp<br />/bin/rm lib_BubbleUpClustering_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:32 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/Chrysalis.cc -o obj/analysis/Chrysalis.o<br />./analysis/Chrysalis.cc: In function ‘int main(int, char**)’:<br />./analysis/Chrysalis.cc:384:28: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />     system(command.c_str());<br />                            ^<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:35 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/TranscriptomeGraph.cc -o obj/analysis/TranscriptomeGraph.o<br />./analysis/TranscriptomeGraph.cc: In function ‘int TranscriptomeGraph(vecDNAVector&amp;, FILE*, int, bool)’:<br />./analysis/TranscriptomeGraph.cc:668:20: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (i=0; i&lt;=d.isize()-k; i++) {<br />                    ^<br />/bin/rm -f lib_Chrysalis_temp.a<br />ar -qc  lib_Chrysalis_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/Chrysalis.o obj/analysis/DNAVector.o obj/analysis/TranscriptomeGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./Chrysalis<br />g++ -ggdb3    -fopenmp  -o ./Chrysalis  obj/analysis/Chrysalis.o -L. -lm -pthread     -l_Chrysalis_temp<br />/bin/rm lib_Chrysalis_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:39 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/CreateIwormFastaBundle.cc -o obj/analysis/CreateIwormFastaBundle.o<br />/bin/rm -f lib_CreateIwormFastaBundle_temp.a<br />ar -qc  lib_CreateIwormFastaBundle_temp.a obj/analysis/AACodons.o obj/analysis/CreateIwormFastaBundle.o obj/analysis/DNAVector.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./CreateIwormFastaBundle<br />g++ -ggdb3    -fopenmp  -o ./CreateIwormFastaBundle  obj/analysis/CreateIwormFastaBundle.o -L. -lm -pthread     -l_CreateIwormFastaBundle_temp<br />/bin/rm lib_CreateIwormFastaBundle_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:42 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/GraphFromFasta.cc -o obj/analysis/GraphFromFasta.o<br />./analysis/GraphFromFasta.cc: In function ‘bool SimpleHalves(const DNAVector&amp;)’:<br />./analysis/GraphFromFasta.cc:255:15: warning: suggest parentheses around ‘&amp;&amp;’ within ‘||’ [-Wparentheses]<br />               &amp;&amp; <br />               ^<br />./analysis/GraphFromFasta.cc: In function ‘void report_iworm_graph(std::map&lt;int, Pool&gt;&amp;, std::map&amp;)’:<br />./analysis/GraphFromFasta.cc:631:31: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (int j = 0; j &lt; adjacent_nodes.size(); j++) {<br />                               ^<br />./analysis/GraphFromFasta.cc: In function ‘int main(int, char**)’:<br />./analysis/GraphFromFasta.cc:1164:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (i=0; i bubble_up_cluster_growth(std::map&amp;, std::map&amp;)’:<br />./GraphFromFasta_MPI.cc:706:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                       ^<br />./GraphFromFasta_MPI.cc:727:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                           ^<br />./GraphFromFasta_MPI.cc:834:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (int i = 0; i &lt; pool_vec.size(); i++) {<br />                       ^<br />./GraphFromFasta_MPI.cc: In function ‘void add_unclustered_iworm_contigs(svec&amp;, vecDNAVector&amp;)’:<br />./GraphFromFasta_MPI.cc:1144:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t i = 0; i &lt; p.size(); i++) {<br />                              ^<br />./GraphFromFasta_MPI.cc: In function ‘int main(int, char**)’:<br />./GraphFromFasta_MPI.cc:1453:60: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             if (iworm_counter % 1000 == 0 || iworm_counter == dna.size()-1) {<br />                                                            ^<br />./GraphFromFasta_MPI.cc:1458:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (j=0; j&lt;=d.isize()-k; j++) {<br />                        ^<br />./GraphFromFasta_MPI.cc:1479:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i)<br />                           ^<br />./GraphFromFasta_MPI.cc:1503:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i)<br />                           ^<br />./GraphFromFasta_MPI.cc:2235:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />             for (j=0; j&lt;=d.isize()-k; j++) {<br />                        ^<br />./GraphFromFasta_MPI.cc:2264:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i) {<br />                           ^<br />./GraphFromFasta_MPI.cc:2359:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />                     if (c == i) {<br />                           ^<br />./GraphFromFasta_MPI.cc:2475:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (i=0; i&lt;clustered_pools.isize(); i++) {<br />                ^<br />./GraphFromFasta_MPI.cc:2483:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t j = 0; j &lt; p.size(); j++) {<br />                              ^<br />./GraphFromFasta_MPI.cc:2496:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />         for (size_t j = 0; j &lt; p.size(); j++) {<br />                              ^<br />/bin/rm -f lib_GraphFromFasta_MPI_temp.a<br />ar -qc  lib_GraphFromFasta_MPI_temp.a obj/GraphFromFasta_MPI.o obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./GraphFromFasta_MPI<br />g++ -ggdb3    -fopenmp  -o ./GraphFromFasta_MPI  obj/GraphFromFasta_MPI.o -L. -lm -pthread     -l_GraphFromFasta_MPI_temp<br />/bin/rm lib_GraphFromFasta_MPI_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:53 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/IsoformAugment.cc -o obj/analysis/IsoformAugment.o<br />./analysis/IsoformAugment.cc: In function ‘int main(int, char**)’:<br />./analysis/IsoformAugment.cc:87:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;matchesLeft.isize(); j++) {<br />                ^<br />./analysis/IsoformAugment.cc:122:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;matches.isize(); j++) {<br />                ^<br />/bin/rm -f lib_IsoformAugment_temp.a<br />ar -qc  lib_IsoformAugment_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/IsoformAugment.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./IsoformAugment<br />g++ -ggdb3    -fopenmp  -o ./IsoformAugment  obj/analysis/IsoformAugment.o -L. -lm -pthread     -l_IsoformAugment_temp<br />/bin/rm lib_IsoformAugment_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:27:56 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/JoinTransByPairs.cc -o obj/analysis/JoinTransByPairs.o<br />./analysis/JoinTransByPairs.cc: In function ‘int main(int, char**)’:<br />./analysis/JoinTransByPairs.cc:293:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i&lt;dna.size(); i++) {<br />              ^<br />./analysis/JoinTransByPairs.cc:341:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />   for (i=0; i&lt;dna.size(); i++) {<br />              ^<br />/bin/rm -f lib_JoinTransByPairs_temp.a<br />ar -qc  lib_JoinTransByPairs_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/JoinTransByPairs.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./JoinTransByPairs<br />g++ -ggdb3    -fopenmp  -o ./JoinTransByPairs  obj/analysis/JoinTransByPairs.o -L. -lm -pthread     -l_JoinTransByPairs_temp<br />/bin/rm lib_JoinTransByPairs_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:00 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/QuantifyGraph.cc -o obj/analysis/QuantifyGraph.o<br />/bin/rm -f lib_QuantifyGraph_temp.a<br />ar -qc  lib_QuantifyGraph_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/QuantifyGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./QuantifyGraph<br />g++ -ggdb3    -fopenmp  -o ./QuantifyGraph  obj/analysis/QuantifyGraph.o -L. -lm -pthread     -l_QuantifyGraph_temp<br />/bin/rm lib_QuantifyGraph_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:03 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/ReadsToTranscripts.cc -o obj/analysis/ReadsToTranscripts.o<br />/bin/rm -f lib_ReadsToTranscripts_temp.a<br />ar -qc  lib_ReadsToTranscripts_temp.a obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/analysis/ReadsToTranscripts.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts  obj/analysis/ReadsToTranscripts.o -L. -lm -pthread     -l_ReadsToTranscripts_temp<br />/bin/rm lib_ReadsToTranscripts_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:09 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./ReadsToTranscripts_MPI.cc -o obj/ReadsToTranscripts_MPI.o<br />/bin/rm -f lib_ReadsToTranscripts_MPI_temp.a<br />ar -qc  lib_ReadsToTranscripts_MPI_temp.a obj/ReadsToTranscripts_MPI.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts_MPI<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts_MPI  obj/ReadsToTranscripts_MPI.o -L. -lm -pthread     -l_ReadsToTranscripts_MPI_temp<br />/bin/rm lib_ReadsToTranscripts_MPI_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:14 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./ReadsToTranscripts_MPI_chang.cc -o obj/ReadsToTranscripts_MPI_chang.o<br />/bin/rm -f lib_ReadsToTranscripts_MPI_chang_temp.a<br />ar -qc  lib_ReadsToTranscripts_MPI_chang_temp.a obj/ReadsToTranscripts_MPI_chang.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./ReadsToTranscripts_MPI_chang<br />g++ -ggdb3    -fopenmp  -o ./ReadsToTranscripts_MPI_chang  obj/ReadsToTranscripts_MPI_chang.o -L. -lm -pthread     -l_ReadsToTranscripts_MPI_chang_temp<br />/bin/rm lib_ReadsToTranscripts_MPI_chang_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:18 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/RunButterfly.cc -o obj/analysis/RunButterfly.o<br />./analysis/RunButterfly.cc: In member function ‘void JobControl::ClearFiles()’:<br />./analysis/RunButterfly.cc:107:25: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />       system(rm.c_str());<br />                         ^<br />./analysis/RunButterfly.cc: In member function ‘void JobControl::Submit()’:<br />./analysis/RunButterfly.cc:77:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />    system(theCmmd.c_str());<br />                           ^<br />./analysis/RunButterfly.cc:85:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]<br />    system(theCmmd.c_str());   <br />                           ^<br />/bin/rm -f lib_RunButterfly_temp.a<br />ar -qc  lib_RunButterfly_temp.a obj/analysis/RunButterfly.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./RunButterfly<br />g++ -ggdb3    -fopenmp  -o ./RunButterfly  obj/analysis/RunButterfly.o -L. -lm -pthread     -l_RunButterfly_temp<br />/bin/rm lib_RunButterfly_temp.a<br />g++  -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels  -O3  -ggdb3 -DMAKE_DATE='"Die Jul  3 11:28:23 CEST 2018  "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread  -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines   -fopenmp        -c ./analysis/TranscriptomeFromVaryK.cc -o obj/analysis/TranscriptomeFromVaryK.o<br />./analysis/TranscriptomeFromVaryK.cc: In function ‘int main(int, char**)’:<br />./analysis/TranscriptomeFromVaryK.cc:216:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />     for (j=0; j&lt;=d.lsize()-k; j++) {<br />                ^<br />./analysis/TranscriptomeFromVaryK.cc:218:22: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]<br />       for (int x=j; x&lt;j+k; x++) {<br />                      ^<br />/bin/rm -f lib_TranscriptomeFromVaryK_temp.a<br />ar -qc  lib_TranscriptomeFromVaryK_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/TranscriptomeFromVaryK.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o<br />./checkLock ./TranscriptomeFromVaryK<br />g++ -ggdb3    -fopenmp  -o ./TranscriptomeFromVaryK  obj/analysis/TranscriptomeFromVaryK.o -L. -lm -pthread     -l_TranscriptomeFromVaryK_temp<br />/bin/rm lib_TranscriptomeFromVaryK_temp.a<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'<br />cd trinity-plugins &amp;&amp; make trinity_essentials<br />make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'<br />tar xvf seqtk-trinity.v0.0.2.tar.gz<br />seqtk-trinity-0.0.2/<br />seqtk-trinity-0.0.2/.gitignore<br />seqtk-trinity-0.0.2/LICENSE<br />seqtk-trinity-0.0.2/Makefile<br />seqtk-trinity-0.0.2/README.md<br />seqtk-trinity-0.0.2/khash.h<br />seqtk-trinity-0.0.2/kseq.h<br />seqtk-trinity-0.0.2/seqtk.c<br />seqtk-trinity-0.0.2/testing/<br />seqtk-trinity-0.0.2/testing/newformat_1.fq<br />seqtk-trinity-0.0.2/testing/newformat_2.fq<br />seqtk-trinity-0.0.2/testing/oldformat_1.fq<br />seqtk-trinity-0.0.2/testing/oldformat_2.fq<br />cd seqtk-trinity-0.0.2 &amp;&amp; make<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'<br />gcc -g -Wall -O2 -Wno-unused-function seqtk.c -o seqtk-trinity -lz -lm<br />seqtk.c: In function ‘stk_comp’:<br />seqtk.c:444:16: warning: variable ‘lc’ set but not used [-Wunused-but-set-variable]<br />    int la, lb, lc, na, nb, nc, cnt[11];<br />                ^<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'<br />mv seqtk-trinity-0.0.2/seqtk-trinity ./BIN/.<br />tar -zxvf "ParaFly-0.1.0".tar.gz &amp;&amp; \<br />cd "ParaFly-0.1.0" &amp;&amp; sh ./configure --prefix=`pwd` &amp;&amp; make install &amp;&amp; \<br />cp bin/ParaFly ../BIN/<br />ParaFly-0.1.0/<br />ParaFly-0.1.0/LICENSE<br />ParaFly-0.1.0/Makefile<br />ParaFly-0.1.0/Makefile.am<br />ParaFly-0.1.0/Makefile.in<br />ParaFly-0.1.0/README.md<br />ParaFly-0.1.0/aclocal.m4<br />ParaFly-0.1.0/bin/<br />ParaFly-0.1.0/bin/ParaFly<br />ParaFly-0.1.0/config.h<br />ParaFly-0.1.0/config.h.in<br />ParaFly-0.1.0/config.log<br />ParaFly-0.1.0/config.status<br />ParaFly-0.1.0/configure<br />ParaFly-0.1.0/configure.ac<br />ParaFly-0.1.0/depcomp<br />ParaFly-0.1.0/install-sh<br />ParaFly-0.1.0/missing<br />ParaFly-0.1.0/src/<br />ParaFly-0.1.0/src/.deps/<br />ParaFly-0.1.0/src/.deps/ParaFly.Po<br />ParaFly-0.1.0/src/.deps/argProcessor.Po<br />ParaFly-0.1.0/src/Makefile<br />ParaFly-0.1.0/src/Makefile.am<br />ParaFly-0.1.0/src/Makefile.in<br />ParaFly-0.1.0/src/ParaFly.cpp<br />ParaFly-0.1.0/src/argProcessor.cpp<br />ParaFly-0.1.0/src/argProcessor.hpp<br />ParaFly-0.1.0/stamp-h1<br />ParaFly-0.1.0/test/<br />ParaFly-0.1.0/test/Makefile<br />ParaFly-0.1.0/test/cmds.txt<br />ParaFly-0.1.0/test/rand_exit.pl<br />checking for a BSD-compatible install... /usr/bin/install -c<br />checking whether build environment is sane... yes<br />checking for a thread-safe mkdir -p... /bin/mkdir -p<br />checking for gawk... gawk<br />checking whether make sets $(MAKE)... yes<br />checking for g++... g++<br />checking for C++ compiler default output file name... a.out<br />checking whether the C++ compiler works... yes<br />checking whether we are cross compiling... no<br />checking for suffix of executables... <br />checking for suffix of object files... o<br />checking whether we are using the GNU C++ compiler... yes<br />checking whether g++ accepts -g... yes<br />checking for style of include used by make... GNU<br />checking dependency style of g++... gcc3<br />checking for library containing cos... none required<br />configure: creating ./config.status<br />config.status: creating Makefile<br />config.status: creating src/Makefile<br />config.status: creating config.h<br />config.status: config.h is unchanged<br />config.status: executing depfiles commands<br />make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />Making install in src<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />g++ -DHAVE_CONFIG_H -I. -I..    -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT ParaFly.o -MD -MP -MF .deps/ParaFly.Tpo -c -o ParaFly.o ParaFly.cpp<br />mv -f .deps/ParaFly.Tpo .deps/ParaFly.Po<br />g++ -DHAVE_CONFIG_H -I. -I..    -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp<br />mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po<br />g++ -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2   -o ParaFly ParaFly.o argProcessor.o  <br />make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin"<br />  /usr/bin/install -c ParaFly '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin'<br />make[4]: Nothing to be done for 'install-data-am'.<br />make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'<br />make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[4]: Nothing to be done for 'install-exec-am'.<br />make[4]: Nothing to be done for 'install-data-am'.<br />make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'<br />ln -sf Trimmomatic-0.36 Trimmomatic<br />make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'<br />sh ./util/support_scripts/trinity_install_tests.sh<br />~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~</p>

<p>Performing Unit Tests of Build<br /> <br />~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~<br />Inchworm:                has been Installed Properly<br />Chrysalis:               has been Installed Properly<br />QuantifyGraph:           has been Installed Properly<br />GraphFromFasta:          has been Installed Properly<br />ReadsToTranscripts:      has been Installed Properly<br />parafly:                 has been Installed Properly<br />➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗<br />➜  trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ ./Trinity</p>

<p>###############################################################################<br />#</p>

<p>     ______  ____   ____  ____   ____  ______  __ __<br />    |      ||    \ |    ||    \ |    ||      ||  |  |<br />    |      ||  D  ) |  | |  _  | |  | |      ||  |  |<br />    |_|  |_||    /  |  | |  |  | |  | |_|  |_||  ~  |<br />      |  |  |    \  |  | |  |  | |  |   |  |  |___, |<br />      |  |  |  .  \ |  | |  |  | |  |   |  |  |     |<br />      |__|  |__|\_||____||__|__||____|  |__|  |____/</p>

<p>#<br />#<br /># Required:<br />#<br />#  --seqType &lt;string&gt;      :type of reads: ('fa' or 'fq')<br />#<br />#  --max_memory       :suggested max memory to use by Trinity where limiting can be enabled. (jellyfish, sorting, etc)<br />#                            provided in Gb of RAM, ie.  '--max_memory 10G'<br />#<br />#  If paired reads:<br />#      --left      :left reads, one or more file names (separated by commas, no spaces)<br />#      --right     :right reads, one or more file names (separated by commas, no spaces)<br />#<br />#  Or, if unpaired reads:<br />#      --single    :single reads, one or more file names, comma-delimited (note, if single file contains pairs, can use flag: --run_as_paired )<br />#<br />#  Or,<br />#      --samples_file          tab-delimited text file indicating biological replicate relationships.<br />#                                   ex.<br />#                                        cond_A    cond_A_rep1    A_rep1_left.fq    A_rep1_right.fq<br />#                                        cond_A    cond_A_rep2    A_rep2_left.fq    A_rep2_right.fq<br />#                                        cond_B    cond_B_rep1    B_rep1_left.fq    B_rep1_right.fq<br />#                                        cond_B    cond_B_rep2    B_rep2_left.fq    B_rep2_right.fq<br />#<br />#                      # if single-end instead of paired-end, then leave the 4th column above empty.<br />#<br />####################################<br />##  Misc:  #########################<br />#<br />#  --SS_lib_type           :Strand-specific RNA-Seq read orientation.<br />#                                   if paired: RF or FR,<br />#                                   if single: F or R.   (dUTP method = RF)<br />#                                   See web documentation.<br />#<br />#  --CPU                      :number of CPUs to use, default: 2<br />#  --min_contig_length        :minimum assembled contig length to report<br />#                                   (def=200)<br />#<br />#  --long_reads            :fasta file containing error-corrected or circular consensus (CCS) pac bio reads<br />#                                   (** note: experimental parameter **, this functionality continues to be under development)<br />#<br />#  --genome_guided_bam     :genome guided mode, provide path to coordinate-sorted bam file.<br />#                                   (see genome-guided param section under --show_full_usage_info)<br />#<br />#  --jaccard_clip                  :option, set if you have paired reads and<br />#                                   you expect high gene density with UTR<br />#                                   overlap (use FASTQ input file format<br />#                                   for reads).<br />#                                   (note: jaccard_clip is an expensive<br />#                                   operation, so avoid using it unless<br />#                                   necessary due to finding excessive fusion<br />#                                   transcripts w/o it.)<br />#<br />#  --trimmomatic                   :run Trimmomatic to quality trim reads<br />#                                        see '--quality_trimming_params' under full usage info for tailored settings.<br />#                                  <br />#<br />#  --no_normalize_reads            :Do *not* run in silico normalization of reads. Defaults to max. read coverage of 50.<br />#                                       see '--normalize_max_read_cov' under full usage info for tailored settings.<br />#                                       (note, as of Sept 21, 2016, normalization is on by default)<br />#     <br />#  --no_distributed_trinity_exec   :do not run Trinity phase 2 (assembly of partitioned reads), and stop after generating command list.<br />#<br />#<br />#  --output                :name of directory for output (will be<br />#                                   created if it doesn't already exist)<br />#                                   default( your current working directory: "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity_out_dir" <br />#                                    note: must include 'trinity' in the name as a safety precaution! )<br />#             <br />#  --workdir               :where Trinity phase-2 assembly computation takes place (defaults to --output setting).<br />#                                  (can set this to a node-local drive or RAM disk)     <br />#  <br />#  --full_cleanup                  :only retain the Trinity fasta file, rename as ${output_dir}.Trinity.fasta<br />#<br />#  --cite                          :show the Trinity literature citation<br />#<br />#  --verbose                       :provide additional job status info during the run.<br />#<br />#  --version                       :reports Trinity version (Trinity-v2.6.6) and exits.<br />#<br />#  --show_full_usage_info          :show the many many more options available for running Trinity (expert usage).<br />#<br />#<br />###############################################################################<br />#<br />#  *Note, a typical Trinity command might be:<br />#<br />#        Trinity --seqType fq --max_memory 50G --left reads_1.fq  --right reads_2.fq --CPU 6<br />#<br />#<br />#    and for Genome-guided Trinity:<br />#<br />#        Trinity --genome_guided_bam rnaseq_alignments.csorted.bam --max_memory 50G<br />#                --genome_guided_max_intron 10000 --CPU 6<br />#<br />#     see: /home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/sample_data/test_Trinity_Assembly/<br />#          for sample data and 'runMe.sh' for example Trinity execution<br />#<br />#     For more details, visit: http://trinityrnaseq.github.io<br />#<br />###############################################################################</p>
]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11735/search-shell-command-history</guid>
	<pubDate>Thu, 12 Jun 2014 17:43:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11735/search-shell-command-history</link>
	<title><![CDATA[Search Shell Command History]]></title>
	<description><![CDATA[<p>We use couple of hundreads of command in daily basis. Most of them are actually repeated several time. The question remain open how do I search old command history under bash shell and modify or reuse it? <br /><br />Now a days almost all modern shell allows you to search command history if enabled by user. Use history command to display the history list with line numbers. Lines listed with with a * have been modified by user.</p><p><br /><strong>Shell history search command</strong><br /><br />Type history at a shell prompt:<br />$ history</p><p>It will display the list of all used commandline history with an serial number.<br /><br />To search particular command, enter:<br />$ history | grep command-name<br />$ history | egrep -i 'scp|ssh|ftp'<br />Emacs Line-Edit Mode Command History Searching<br /><br />To get previous command containing string, hit [CTRL]+[r] followed by search string:<br /><br />(reverse-i-search): <br /><br />To get previous command, hit [CTRL]+[p]. You can also use up arrow key.<br /><br />CTRL-p<br /><br />To get next command, hit [CTRL]+[n]. You can also use down arrow key.<br /><br />CTRL-n<br /><br /></p><p><strong>fc command</strong></p><p>Apart from hostory command there are fc command to extract the command from history. The fc stands for either "find command" or "fix command.</p><p>For example list last 10 command, enter:<br />$ fc -l 10<br />To list commands 130 through 150, enter:<br />$ fc -l 130 150<br />To list all commands since the last command beginning with ssh, enter:<br />$ fc -l ssh<br />You can edit commands 1 through 5 using vi text editor, enter:<br />$ fc -e vi 1 5</p><p><strong>Delete command history</strong><br /><br />The -c option causes the history list to be cleared by deleting all of the entries:<br />$ history -c</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40889/rcorrector-efficient-and-accurate-error-correction-for-illumina-rna-seq-reads</guid>
	<pubDate>Tue, 04 Feb 2020 23:23:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40889/rcorrector-efficient-and-accurate-error-correction-for-illumina-rna-seq-reads</link>
	<title><![CDATA[Rcorrector: efficient and accurate error correction for Illumina RNA-seq reads]]></title>
	<description><![CDATA[<p><span>Rcorrector has an accuracy higher than or comparable to existing methods, including the only other method (SEECER) designed for RNA-seq reads, and is more time and memory efficient. With a 5 GB memory footprint for 100 million reads, it can be run on virtually any desktop or server. The software is available free of charge under the GNU General Public License from&nbsp;</span><a href="https://github.com/mourisl/Rcorrector/" target="_blank">https://github.com/mourisl/Rcorrector/</a><span>.</span></p>
<pre><code>Usage: perl run_rcorrector.pl [OPTIONS]
OPTIONS:
	Required
	-s seq_files: comma separated files for single-end data sets
	-1 seq_files_left: comma separated files for the first mate in the paried-end data sets
	-2 seq_files_right: comma separated files for the second mate in the paired-end data sets
	-i seq_files_interleaved: comma sperated files for interleaved paired-end data sets
	Optional
	-k INT: kmer_length (&lt;=32, default: 23)
	-od STRING: output_file_directory (default: ./)
	-t INT: number of threads to use (default: 1)
	-trim : allow trimming (default: false)
	-maxcorK INT: the maximum number of correction within k-bp window (default: 4)
	-wk FLOAT: the proportion of kmers that are used to estimate weak kmer count threshold, lower for more divergent genome (default: 0.95)
	-ek INT: expected number of kmers; does not affect the correctness of program but affects the memory usage (default: 100000000)
	-stdout: output the corrected reads to stdout (default: not used)
	-verbose: output some correction information to stdout (default: not used)
	-stage INT: start from which stage (default: 0)
		0-start from begining(storing kmers in bloom filter) ;
		1-start from count kmers showed up in bloom filter;
		2-start from dumping kmer counts into a jf_dump file;
		3-start from error correction.</code></pre><p>Address of the bookmark: <a href="https://github.com/mourisl/Rcorrector/" rel="nofollow">https://github.com/mourisl/Rcorrector/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/11609/bioinformatician%E2%80%99s-pocket-reference</guid>
	<pubDate>Sun, 08 Jun 2014 09:56:58 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/11609/bioinformatician%E2%80%99s-pocket-reference</link>
	<title><![CDATA[Bioinformatician’s Pocket Reference !!]]></title>
	<description><![CDATA[<p><span>It is amusing how brain of bioinformaticians work! Learning a new programming language for days feels so much of fun that making 5 minute discussion with neighbours (unless under special circumstances!) in our own mother-tongue. Today every bioinformatician keeps more than few languages and core IT toolkits on their plate. It has become mandatory to be able to mould different code snippets to build our own custom workflows, and thus keeping syntax at our fingertips has become essential.Although Google is best way to get syntax problem solved, it is not a bad idea to keep reference sheets is our smartphones or stick out some printed sheets on the back of your door, in the old fashion way!!</span></p><p>Address of the bookmark: <a href="http://infoplatter.wordpress.com/2014/04/06/bioinformaticians-pocket-reference/" rel="nofollow">http://infoplatter.wordpress.com/2014/04/06/bioinformaticians-pocket-reference/</a></p>]]></description>
	<dc:creator>RAJESH DETROJA</dc:creator>
</item>

</channel>
</rss>