The Indian scientists working in Bangalore, along with their American counterparts, have mapped more than 17,000 proteins in 30 organs of the human body. Just like the human genome was sequenced around the turn of the millennium, this is an equivalent mapping of the human proteome.

The researcher estimated there are around 20,500 proteins in the human body. These scientists have profiled around 17,294, which account for around 84% of the total proteins. Apart from this, the team also traced around 2,500 of 3,000 proteins that had been categorised as "missing proteins".

The work, done by group of Indian scientists, and Johns Hopkins University, published in the renowned journal Nature ( http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html ). Of the 72 people who worked on the project, 46 are Indians.

Reference:

http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html

http://www.proteinatlas.org/ -The antibody-based Human Protein Atlas programme

http://www.humanproteomemap.org/ -Proteogenomic analysis by identifying translated proteins from annotated pseudogenes, non-coding RNAs and untranslated regions.

https://www.proteomicsdb.org/ -Assembled protein evidence for 18,097 genes in ProteomicsDB

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

First cover a full workflow from preparation, reads counting, data preprocessing, gene set test, to pathway visualization in about 40 lines of codes. The same workflow can be used for GO analysis or other types of gene set analysis too. We also describe joint workflows, i.e. to do gene-level analysis using one of the major RNA-Seq analysis tools, DEseq/DEseq2, edgeR, limma and Cufflinks, and feed the results into GAGE/Pahview for pathway analysis or visualization. All these workflows are implemented in R/Bioconductor.

The work ows cover the most common situations and issues for RNA-Seq data pathway analysis. Issues like data quality assessment are relevant for data analysis in general yet out the scope of this tutorial. Although we focus on RNA-Seq data here, but pathway analysis work ow remains similar for microarray, particularly step 3-4 would be the same. Please check gage and pathview vigenttes for details.

Note: You need to update to current release versions of R(3.0.2)/ Bioconductor(2.13) to use all the features. 

Reference: 

Please check it out:
http://bioconductor.org/packages/release/bioc/html/gage.html
http://bioconductor.org/packages/release/bioc/vignettes/gage/inst/doc/RNA-seqWorkflow.pdf

No.NITW/BT/2014/adhoc

APPLICATIONS ARE INVITED FOR THE APPOINTMENT OF ADHOC FACULTY ON CONTRACT BASIS IN THE DEAPARTMENT OF BIOTECHNOLOGY

Period of Contract: Initially the appointment is for one semester i.e., from July 2014 up to December 2014 only.

Essential Qualifications:

i) B. Tech or equivalent in Biotechnology/ Industrial Biotechnology/ Biochemical Engineering / Chemical Engg. Or M. Sc in Microbiology/ Botany/ Zoology/ Biochemistry/Biotechnology and ii) M. Tech or equivalent in Biotechnology/Industrial Biotechnology/Bioinformatics

Or

Integrated M. Tech in Biotechnology/Industrial Biotechnology/ Bioinformatics

Candidates must possess First class (60% aggregate marks or 6.5 CGPA) at B. Tech/ M. Sc and M. Tech.

Desirable: Ph. D Pay Package: All selected candidates shall be eligible for a consolidated pay of Rs.30, 000/- per month. Candidates with Ph. D shall be eligible for an additional amount of Rs.5, 000/- per month.

How to apply : Applications on plain paper with attested photocopies of certificate and bio data along with justification for eligibility should reach to the Head, Department of Biotechnology, National Institute of Technology, Warangal AP 506004 in the form of soft or hard copy on or before 21st June 2014 email : biotech_hod@nitw.ac.in

Intimation: No separate call letters will be sent to the candidates. All the eligible candidates will be notified in the institute web site on 23rd June 2014. All the eligible candidates are requested to report for the interview to the Head, Department of Biotechnology at 9:00 AM on 27th June 2014

Joining: Selected candidates will be informed and they are expected to join immediately.

Advertisement:

http://www.nitw.ac.in/nitw/announcements/2014/Bio-Adhoc%20Advt.%20May-2014.pdf

➜ cd trinityrnaseq-Trinity-v2.6.6

➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ make
Using gnu compiler for Inchworm and Chrysalis
cd Inchworm && (test -e configure || autoreconf) \
&& sh ./configure --prefix=`pwd` && make install
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for g++... g++
checking whether the C++ compiler works... yes
checking for C++ compiler default output file name... a.out
checking for suffix of executables...
checking whether we are cross compiling... no
checking for suffix of object files... o
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking for style of include used by make... GNU
checking dependency style of g++... gcc3
checking for library containing cos... none required
configure: creating ./config.status
config.status: creating Makefile
config.status: creating src/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
Making install in src
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_entry.o -MD -MP -MF .deps/Fasta_entry.Tpo -c -o Fasta_entry.o Fasta_entry.cpp
mv -f .deps/Fasta_entry.Tpo .deps/Fasta_entry.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE_run.o -MD -MP -MF .deps/IRKE_run.Tpo -c -o IRKE_run.o IRKE_run.cpp
mv -f .deps/IRKE_run.Tpo .deps/IRKE_run.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT sequenceUtil.o -MD -MP -MF .deps/sequenceUtil.Tpo -c -o sequenceUtil.o sequenceUtil.cpp
mv -f .deps/sequenceUtil.Tpo .deps/sequenceUtil.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE.o -MD -MP -MF .deps/IRKE.Tpo -c -o IRKE.o IRKE.cpp
mv -f .deps/IRKE.Tpo .deps/IRKE.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT KmerCounter.o -MD -MP -MF .deps/KmerCounter.Tpo -c -o KmerCounter.o KmerCounter.cpp
mv -f .deps/KmerCounter.Tpo .deps/KmerCounter.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT string_util.o -MD -MP -MF .deps/string_util.Tpo -c -o string_util.o string_util.cpp
mv -f .deps/string_util.Tpo .deps/string_util.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_reader.o -MD -MP -MF .deps/Fasta_reader.Tpo -c -o Fasta_reader.o Fasta_reader.cpp
mv -f .deps/Fasta_reader.Tpo .deps/Fasta_reader.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT stacktrace.o -MD -MP -MF .deps/stacktrace.Tpo -c -o stacktrace.o stacktrace.cpp
mv -f .deps/stacktrace.Tpo .deps/stacktrace.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp
mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o inchworm Fasta_entry.o IRKE_run.o sequenceUtil.o IRKE.o KmerCounter.o string_util.o Fasta_reader.o stacktrace.o argProcessor.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT cigar_tweaker.o -MD -MP -MF .deps/cigar_tweaker.Tpo -c -o cigar_tweaker.o cigar_tweaker.cpp
mv -f .deps/cigar_tweaker.Tpo .deps/cigar_tweaker.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_entry.o -MD -MP -MF .deps/SAM_entry.Tpo -c -o SAM_entry.o SAM_entry.cpp
mv -f .deps/SAM_entry.Tpo .deps/SAM_entry.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_reader.o -MD -MP -MF .deps/SAM_reader.Tpo -c -o SAM_reader.o SAM_reader.cpp
mv -f .deps/SAM_reader.Tpo .deps/SAM_reader.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Cigar.o -MD -MP -MF .deps/Cigar.Tpo -c -o Cigar.o Cigar.cpp
mv -f .deps/Cigar.Tpo .deps/Cigar.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o cigar_tweaker cigar_tweaker.o SAM_entry.o sequenceUtil.o SAM_reader.o Cigar.o string_util.o stacktrace.o Fasta_reader.o Fasta_entry.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT pull_reads_with_kmers.o -MD -MP -MF .deps/pull_reads_with_kmers.Tpo -c -o pull_reads_with_kmers.o pull_reads_with_kmers.cpp
mv -f .deps/pull_reads_with_kmers.Tpo .deps/pull_reads_with_kmers.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o pull_reads_with_kmers pull_reads_with_kmers.o Fasta_reader.o Fasta_entry.o sequenceUtil.o KmerCounter.o string_util.o stacktrace.o argProcessor.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT FastaToDeBruijn.o -MD -MP -MF .deps/FastaToDeBruijn.Tpo -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp
FastaToDeBruijn.cpp: In function ‘void createGraphPerRecord(std::vector >, int, bool, ArgProcessor)’:
FastaToDeBruijn.cpp:199:39: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (seq_region.size() < kmer_length) { continue; } // can be e
^
mv -f .deps/FastaToDeBruijn.Tpo .deps/FastaToDeBruijn.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT DeBruijnGraph.o -MD -MP -MF .deps/DeBruijnGraph.Tpo -c -o DeBruijnGraph.o DeBruijnGraph.cpp
mv -f .deps/DeBruijnGraph.Tpo .deps/DeBruijnGraph.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o FastaToDeBruijn FastaToDeBruijn.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o DeBruijnGraph.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT fastaToKmerCoverageStats.o -MD -MP -MF .deps/fastaToKmerCoverageStats.Tpo -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp
fastaToKmerCoverageStats.cpp: In function ‘void populate_kmer_counter_from_reads(KmerCounter&, std::__cxx11::string&)’:
fastaToKmerCoverageStats.cpp:226:18: warning: unused variable ‘kmer_length’ [-Wunused-variable]
unsigned int kmer_length = kcounter.get_kmer_length();
^
mv -f .deps/fastaToKmerCoverageStats.Tpo .deps/fastaToKmerCoverageStats.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o fastaToKmerCoverageStats fastaToKmerCoverageStats.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o KmerCounter.o
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin"
/usr/bin/install -c inchworm cigar_tweaker pull_reads_with_kmers FastaToDeBruijn fastaToKmerCoverageStats '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin'
make[3]: Nothing to be done for 'install-data-am'.
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[3]: Nothing to be done for 'install-exec-am'.
make[3]: Nothing to be done for 'install-data-am'.
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
cd Chrysalis && make UNSUPPORTED=yes
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'
./MakeDepend.cc: In member function ‘bool makefile_builder::dependency::operator<(const makefile_builder::dependency&) const’:
./MakeDepend.cc:93:47: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
dependent_ == other.dependent_ &&
^
./MakeDepend.cc: In member function ‘bool makefile_builder::subdir_and_target::operator<(const makefile_builder::subdir_and_target&) const’:
./MakeDepend.cc:130:41: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
subdir_ == other.subdir_ &&
^
./MakeDepend.cc: In function ‘int main(int, char**)’:
./MakeDepend.cc:223:20: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
char * options = "Ad:g:u:fh";
^
./MakeDepend.cc: In member function ‘void makefile_builder::DumpDependencies(const string&)’:
./MakeDepend.cc:491:46: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
if ( ! this->FileIsSource( dependent ) && ! this->FileIsHeader( dependent
^
./MakeDepend.cc:493:44: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
this->FileIsHeader( dependent ) && this->FileIsSource( provider ) )
^
./MakeDepend.cc: In member function ‘bool makefile_builder::FileIsHeader(const string&) const’:
./MakeDepend.cc:1339:32: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
return ( filename.size() > 2 &&
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:04 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./aligns/KmerAlignCore.cc -o obj/aligns/KmerAlignCore.o
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:06 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/AACodons.cc -o obj/analysis/AACodons.o
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:09 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/BreakTransByPairs.cc -o obj/analysis/BreakTransByPairs.o
./analysis/BreakTransByPairs.cc: In function ‘int main(int, char**)’:
./analysis/BreakTransByPairs.cc:105:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i > DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’:
./analysis/DeBruijnGraph.cc:473:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < left_extensions.size(); i++) {
^
./analysis/DeBruijnGraph.cc:476:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int j = 0; j < right_extensions.size(); j++) {
^
./analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&, std::vector >&, char, std::map&, int)’:
./analysis/DeBruijnGraph.cc:513:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < adjacent_kmers.size(); i++) {
^
./analysis/DeBruijnGraph.cc:527:41: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (kmer_extension_chars.size() == flank_extension_length) {
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:30 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/sequenceUtil.cc -o obj/analysis/sequenceUtil.o
./analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::__cxx11::string)’:
./analysis/sequenceUtil.cc:33:20: warning: array subscript has type ‘char’ [-Wchar-subscripts]
if (_base_to_int[c] > 3)
^
./analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::__cxx11::string)’:
./analysis/sequenceUtil.cc:264:26: warning: array subscript has type ‘char’ [-Wchar-subscripts]
int val = _base_to_int[c];
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:31 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/stacktrace.cc -o obj/analysis/stacktrace.o
/bin/rm -f lib_BubbleUpClustering_temp.a
ar -qc lib_BubbleUpClustering_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/BubbleUpClustering.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./BubbleUpClustering
g++ -ggdb3 -fopenmp -o ./BubbleUpClustering obj/analysis/BubbleUpClustering.o -L. -lm -pthread -l_BubbleUpClustering_temp
/bin/rm lib_BubbleUpClustering_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:32 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/Chrysalis.cc -o obj/analysis/Chrysalis.o
./analysis/Chrysalis.cc: In function ‘int main(int, char**)’:
./analysis/Chrysalis.cc:384:28: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(command.c_str());
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:35 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/TranscriptomeGraph.cc -o obj/analysis/TranscriptomeGraph.o
./analysis/TranscriptomeGraph.cc: In function ‘int TranscriptomeGraph(vecDNAVector&, FILE*, int, bool)’:
./analysis/TranscriptomeGraph.cc:668:20: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<=d.isize()-k; i++) {
^
/bin/rm -f lib_Chrysalis_temp.a
ar -qc lib_Chrysalis_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/Chrysalis.o obj/analysis/DNAVector.o obj/analysis/TranscriptomeGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./Chrysalis
g++ -ggdb3 -fopenmp -o ./Chrysalis obj/analysis/Chrysalis.o -L. -lm -pthread -l_Chrysalis_temp
/bin/rm lib_Chrysalis_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:39 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/CreateIwormFastaBundle.cc -o obj/analysis/CreateIwormFastaBundle.o
/bin/rm -f lib_CreateIwormFastaBundle_temp.a
ar -qc lib_CreateIwormFastaBundle_temp.a obj/analysis/AACodons.o obj/analysis/CreateIwormFastaBundle.o obj/analysis/DNAVector.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./CreateIwormFastaBundle
g++ -ggdb3 -fopenmp -o ./CreateIwormFastaBundle obj/analysis/CreateIwormFastaBundle.o -L. -lm -pthread -l_CreateIwormFastaBundle_temp
/bin/rm lib_CreateIwormFastaBundle_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:42 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/GraphFromFasta.cc -o obj/analysis/GraphFromFasta.o
./analysis/GraphFromFasta.cc: In function ‘bool SimpleHalves(const DNAVector&)’:
./analysis/GraphFromFasta.cc:255:15: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
&&
^
./analysis/GraphFromFasta.cc: In function ‘void report_iworm_graph(std::map<int, Pool>&, std::map&)’:
./analysis/GraphFromFasta.cc:631:31: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int j = 0; j < adjacent_nodes.size(); j++) {
^
./analysis/GraphFromFasta.cc: In function ‘int main(int, char**)’:
./analysis/GraphFromFasta.cc:1164:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i bubble_up_cluster_growth(std::map&, std::map&)’:
./GraphFromFasta_MPI.cc:706:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc:727:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc:834:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc: In function ‘void add_unclustered_iworm_contigs(svec&, vecDNAVector&)’:
./GraphFromFasta_MPI.cc:1144:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t i = 0; i < p.size(); i++) {
^
./GraphFromFasta_MPI.cc: In function ‘int main(int, char**)’:
./GraphFromFasta_MPI.cc:1453:60: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (iworm_counter % 1000 == 0 || iworm_counter == dna.size()-1) {
^
./GraphFromFasta_MPI.cc:1458:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.isize()-k; j++) {
^
./GraphFromFasta_MPI.cc:1479:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i)
^
./GraphFromFasta_MPI.cc:1503:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i)
^
./GraphFromFasta_MPI.cc:2235:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.isize()-k; j++) {
^
./GraphFromFasta_MPI.cc:2264:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i) {
^
./GraphFromFasta_MPI.cc:2359:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i) {
^
./GraphFromFasta_MPI.cc:2475:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<clustered_pools.isize(); i++) {
^
./GraphFromFasta_MPI.cc:2483:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t j = 0; j < p.size(); j++) {
^
./GraphFromFasta_MPI.cc:2496:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t j = 0; j < p.size(); j++) {
^
/bin/rm -f lib_GraphFromFasta_MPI_temp.a
ar -qc lib_GraphFromFasta_MPI_temp.a obj/GraphFromFasta_MPI.o obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./GraphFromFasta_MPI
g++ -ggdb3 -fopenmp -o ./GraphFromFasta_MPI obj/GraphFromFasta_MPI.o -L. -lm -pthread -l_GraphFromFasta_MPI_temp
/bin/rm lib_GraphFromFasta_MPI_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:53 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/IsoformAugment.cc -o obj/analysis/IsoformAugment.o
./analysis/IsoformAugment.cc: In function ‘int main(int, char**)’:
./analysis/IsoformAugment.cc:87:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<matchesLeft.isize(); j++) {
^
./analysis/IsoformAugment.cc:122:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<matches.isize(); j++) {
^
/bin/rm -f lib_IsoformAugment_temp.a
ar -qc lib_IsoformAugment_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/IsoformAugment.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./IsoformAugment
g++ -ggdb3 -fopenmp -o ./IsoformAugment obj/analysis/IsoformAugment.o -L. -lm -pthread -l_IsoformAugment_temp
/bin/rm lib_IsoformAugment_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:56 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/JoinTransByPairs.cc -o obj/analysis/JoinTransByPairs.o
./analysis/JoinTransByPairs.cc: In function ‘int main(int, char**)’:
./analysis/JoinTransByPairs.cc:293:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<dna.size(); i++) {
^
./analysis/JoinTransByPairs.cc:341:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<dna.size(); i++) {
^
/bin/rm -f lib_JoinTransByPairs_temp.a
ar -qc lib_JoinTransByPairs_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/JoinTransByPairs.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./JoinTransByPairs
g++ -ggdb3 -fopenmp -o ./JoinTransByPairs obj/analysis/JoinTransByPairs.o -L. -lm -pthread -l_JoinTransByPairs_temp
/bin/rm lib_JoinTransByPairs_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:00 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/QuantifyGraph.cc -o obj/analysis/QuantifyGraph.o
/bin/rm -f lib_QuantifyGraph_temp.a
ar -qc lib_QuantifyGraph_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/QuantifyGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./QuantifyGraph
g++ -ggdb3 -fopenmp -o ./QuantifyGraph obj/analysis/QuantifyGraph.o -L. -lm -pthread -l_QuantifyGraph_temp
/bin/rm lib_QuantifyGraph_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:03 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/ReadsToTranscripts.cc -o obj/analysis/ReadsToTranscripts.o
/bin/rm -f lib_ReadsToTranscripts_temp.a
ar -qc lib_ReadsToTranscripts_temp.a obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/analysis/ReadsToTranscripts.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts obj/analysis/ReadsToTranscripts.o -L. -lm -pthread -l_ReadsToTranscripts_temp
/bin/rm lib_ReadsToTranscripts_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:09 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./ReadsToTranscripts_MPI.cc -o obj/ReadsToTranscripts_MPI.o
/bin/rm -f lib_ReadsToTranscripts_MPI_temp.a
ar -qc lib_ReadsToTranscripts_MPI_temp.a obj/ReadsToTranscripts_MPI.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts_MPI
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts_MPI obj/ReadsToTranscripts_MPI.o -L. -lm -pthread -l_ReadsToTranscripts_MPI_temp
/bin/rm lib_ReadsToTranscripts_MPI_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:14 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./ReadsToTranscripts_MPI_chang.cc -o obj/ReadsToTranscripts_MPI_chang.o
/bin/rm -f lib_ReadsToTranscripts_MPI_chang_temp.a
ar -qc lib_ReadsToTranscripts_MPI_chang_temp.a obj/ReadsToTranscripts_MPI_chang.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts_MPI_chang
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts_MPI_chang obj/ReadsToTranscripts_MPI_chang.o -L. -lm -pthread -l_ReadsToTranscripts_MPI_chang_temp
/bin/rm lib_ReadsToTranscripts_MPI_chang_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:18 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/RunButterfly.cc -o obj/analysis/RunButterfly.o
./analysis/RunButterfly.cc: In member function ‘void JobControl::ClearFiles()’:
./analysis/RunButterfly.cc:107:25: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(rm.c_str());
^
./analysis/RunButterfly.cc: In member function ‘void JobControl::Submit()’:
./analysis/RunButterfly.cc:77:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(theCmmd.c_str());
^
./analysis/RunButterfly.cc:85:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(theCmmd.c_str());
^
/bin/rm -f lib_RunButterfly_temp.a
ar -qc lib_RunButterfly_temp.a obj/analysis/RunButterfly.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./RunButterfly
g++ -ggdb3 -fopenmp -o ./RunButterfly obj/analysis/RunButterfly.o -L. -lm -pthread -l_RunButterfly_temp
/bin/rm lib_RunButterfly_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:23 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/TranscriptomeFromVaryK.cc -o obj/analysis/TranscriptomeFromVaryK.o
./analysis/TranscriptomeFromVaryK.cc: In function ‘int main(int, char**)’:
./analysis/TranscriptomeFromVaryK.cc:216:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.lsize()-k; j++) {
^
./analysis/TranscriptomeFromVaryK.cc:218:22: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int x=j; x<j+k; x++) {
^
/bin/rm -f lib_TranscriptomeFromVaryK_temp.a
ar -qc lib_TranscriptomeFromVaryK_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/TranscriptomeFromVaryK.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./TranscriptomeFromVaryK
g++ -ggdb3 -fopenmp -o ./TranscriptomeFromVaryK obj/analysis/TranscriptomeFromVaryK.o -L. -lm -pthread -l_TranscriptomeFromVaryK_temp
/bin/rm lib_TranscriptomeFromVaryK_temp.a
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'
cd trinity-plugins && make trinity_essentials
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'
tar xvf seqtk-trinity.v0.0.2.tar.gz
seqtk-trinity-0.0.2/
seqtk-trinity-0.0.2/.gitignore
seqtk-trinity-0.0.2/LICENSE
seqtk-trinity-0.0.2/Makefile
seqtk-trinity-0.0.2/README.md
seqtk-trinity-0.0.2/khash.h
seqtk-trinity-0.0.2/kseq.h
seqtk-trinity-0.0.2/seqtk.c
seqtk-trinity-0.0.2/testing/
seqtk-trinity-0.0.2/testing/newformat_1.fq
seqtk-trinity-0.0.2/testing/newformat_2.fq
seqtk-trinity-0.0.2/testing/oldformat_1.fq
seqtk-trinity-0.0.2/testing/oldformat_2.fq
cd seqtk-trinity-0.0.2 && make
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'
gcc -g -Wall -O2 -Wno-unused-function seqtk.c -o seqtk-trinity -lz -lm
seqtk.c: In function ‘stk_comp’:
seqtk.c:444:16: warning: variable ‘lc’ set but not used [-Wunused-but-set-variable]
int la, lb, lc, na, nb, nc, cnt[11];
^
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'
mv seqtk-trinity-0.0.2/seqtk-trinity ./BIN/.
tar -zxvf "ParaFly-0.1.0".tar.gz && \
cd "ParaFly-0.1.0" && sh ./configure --prefix=`pwd` && make install && \
cp bin/ParaFly ../BIN/
ParaFly-0.1.0/
ParaFly-0.1.0/LICENSE
ParaFly-0.1.0/Makefile
ParaFly-0.1.0/Makefile.am
ParaFly-0.1.0/Makefile.in
ParaFly-0.1.0/README.md
ParaFly-0.1.0/aclocal.m4
ParaFly-0.1.0/bin/
ParaFly-0.1.0/bin/ParaFly
ParaFly-0.1.0/config.h
ParaFly-0.1.0/config.h.in
ParaFly-0.1.0/config.log
ParaFly-0.1.0/config.status
ParaFly-0.1.0/configure
ParaFly-0.1.0/configure.ac
ParaFly-0.1.0/depcomp
ParaFly-0.1.0/install-sh
ParaFly-0.1.0/missing
ParaFly-0.1.0/src/
ParaFly-0.1.0/src/.deps/
ParaFly-0.1.0/src/.deps/ParaFly.Po
ParaFly-0.1.0/src/.deps/argProcessor.Po
ParaFly-0.1.0/src/Makefile
ParaFly-0.1.0/src/Makefile.am
ParaFly-0.1.0/src/Makefile.in
ParaFly-0.1.0/src/ParaFly.cpp
ParaFly-0.1.0/src/argProcessor.cpp
ParaFly-0.1.0/src/argProcessor.hpp
ParaFly-0.1.0/stamp-h1
ParaFly-0.1.0/test/
ParaFly-0.1.0/test/Makefile
ParaFly-0.1.0/test/cmds.txt
ParaFly-0.1.0/test/rand_exit.pl
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for g++... g++
checking for C++ compiler default output file name... a.out
checking whether the C++ compiler works... yes
checking whether we are cross compiling... no
checking for suffix of executables...
checking for suffix of object files... o
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking for style of include used by make... GNU
checking dependency style of g++... gcc3
checking for library containing cos... none required
configure: creating ./config.status
config.status: creating Makefile
config.status: creating src/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
Making install in src
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
g++ -DHAVE_CONFIG_H -I. -I.. -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT ParaFly.o -MD -MP -MF .deps/ParaFly.Tpo -c -o ParaFly.o ParaFly.cpp
mv -f .deps/ParaFly.Tpo .deps/ParaFly.Po
g++ -DHAVE_CONFIG_H -I. -I.. -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp
mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po
g++ -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -o ParaFly ParaFly.o argProcessor.o
make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin"
/usr/bin/install -c ParaFly '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin'
make[4]: Nothing to be done for 'install-data-am'.
make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[4]: Nothing to be done for 'install-exec-am'.
make[4]: Nothing to be done for 'install-data-am'.
make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
ln -sf Trimmomatic-0.36 Trimmomatic
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'
sh ./util/support_scripts/trinity_install_tests.sh
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Performing Unit Tests of Build

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Inchworm: has been Installed Properly
Chrysalis: has been Installed Properly
QuantifyGraph: has been Installed Properly
GraphFromFasta: has been Installed Properly
ReadsToTranscripts: has been Installed Properly
parafly: has been Installed Properly
➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗
➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ ./Trinity

###############################################################################
#

______ ____ ____ ____ ____ ______ __ __
| || \ | || \ | || || | |
| || D ) | | | _ | | | | || | |
|_| |_|| / | | | | | | | |_| |_|| ~ |
| | | \ | | | | | | | | | |___, |
| | | . \ | | | | | | | | | | |
|__| |__|\_||____||__|__||____| |__| |____/

#
#
# Required:
#
# --seqType <string> :type of reads: ('fa' or 'fq')
#
# --max_memory :suggested max memory to use by Trinity where limiting can be enabled. (jellyfish, sorting, etc)
# provided in Gb of RAM, ie. '--max_memory 10G'
#
# If paired reads:
# --left :left reads, one or more file names (separated by commas, no spaces)
# --right :right reads, one or more file names (separated by commas, no spaces)
#
# Or, if unpaired reads:
# --single :single reads, one or more file names, comma-delimited (note, if single file contains pairs, can use flag: --run_as_paired )
#
# Or,
# --samples_file tab-delimited text file indicating biological replicate relationships.
# ex.
# cond_A cond_A_rep1 A_rep1_left.fq A_rep1_right.fq
# cond_A cond_A_rep2 A_rep2_left.fq A_rep2_right.fq
# cond_B cond_B_rep1 B_rep1_left.fq B_rep1_right.fq
# cond_B cond_B_rep2 B_rep2_left.fq B_rep2_right.fq
#
# # if single-end instead of paired-end, then leave the 4th column above empty.
#
####################################
## Misc: #########################
#
# --SS_lib_type :Strand-specific RNA-Seq read orientation.
# if paired: RF or FR,
# if single: F or R. (dUTP method = RF)
# See web documentation.
#
# --CPU :number of CPUs to use, default: 2
# --min_contig_length :minimum assembled contig length to report
# (def=200)
#
# --long_reads :fasta file containing error-corrected or circular consensus (CCS) pac bio reads
# (** note: experimental parameter **, this functionality continues to be under development)
#
# --genome_guided_bam :genome guided mode, provide path to coordinate-sorted bam file.
# (see genome-guided param section under --show_full_usage_info)
#
# --jaccard_clip :option, set if you have paired reads and
# you expect high gene density with UTR
# overlap (use FASTQ input file format
# for reads).
# (note: jaccard_clip is an expensive
# operation, so avoid using it unless
# necessary due to finding excessive fusion
# transcripts w/o it.)
#
# --trimmomatic :run Trimmomatic to quality trim reads
# see '--quality_trimming_params' under full usage info for tailored settings.
#
#
# --no_normalize_reads :Do *not* run in silico normalization of reads. Defaults to max. read coverage of 50.
# see '--normalize_max_read_cov' under full usage info for tailored settings.
# (note, as of Sept 21, 2016, normalization is on by default)
#
# --no_distributed_trinity_exec :do not run Trinity phase 2 (assembly of partitioned reads), and stop after generating command list.
#
#
# --output :name of directory for output (will be
# created if it doesn't already exist)
# default( your current working directory: "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity_out_dir"
# note: must include 'trinity' in the name as a safety precaution! )
#
# --workdir :where Trinity phase-2 assembly computation takes place (defaults to --output setting).
# (can set this to a node-local drive or RAM disk)
#
# --full_cleanup :only retain the Trinity fasta file, rename as ${output_dir}.Trinity.fasta
#
# --cite :show the Trinity literature citation
#
# --verbose :provide additional job status info during the run.
#
# --version :reports Trinity version (Trinity-v2.6.6) and exits.
#
# --show_full_usage_info :show the many many more options available for running Trinity (expert usage).
#
#
###############################################################################
#
# *Note, a typical Trinity command might be:
#
# Trinity --seqType fq --max_memory 50G --left reads_1.fq --right reads_2.fq --CPU 6
#
#
# and for Genome-guided Trinity:
#
# Trinity --genome_guided_bam rnaseq_alignments.csorted.bam --max_memory 50G
# --genome_guided_max_intron 10000 --CPU 6
#
# see: /home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/sample_data/test_Trinity_Assembly/
# for sample data and 'runMe.sh' for example Trinity execution
#
# For more details, visit: http://trinityrnaseq.github.io
#
###############################################################################

Shell history search command

Type history at a shell prompt:
$ history

It will display the list of all used commandline history with an serial number.

To search particular command, enter:
$ history | grep command-name
$ history | egrep -i 'scp|ssh|ftp'
Emacs Line-Edit Mode Command History Searching

To get previous command containing string, hit [CTRL]+[r] followed by search string:

(reverse-i-search):

To get previous command, hit [CTRL]+[p]. You can also use up arrow key.

CTRL-p

To get next command, hit [CTRL]+[n]. You can also use down arrow key.

CTRL-n

fc command

Apart from hostory command there are fc command to extract the command from history. The fc stands for either "find command" or "fix command.

For example list last 10 command, enter:
$ fc -l 10
To list commands 130 through 150, enter:
$ fc -l 130 150
To list all commands since the last command beginning with ssh, enter:
$ fc -l ssh
You can edit commands 1 through 5 using vi text editor, enter:
$ fc -e vi 1 5

Delete command history

The -c option causes the history list to be cleared by deleting all of the entries:
$ history -c

Usage: perl run_rcorrector.pl [OPTIONS]
OPTIONS:
	Required
	-s seq_files: comma separated files for single-end data sets
	-1 seq_files_left: comma separated files for the first mate in the paried-end data sets
	-2 seq_files_right: comma separated files for the second mate in the paired-end data sets
	-i seq_files_interleaved: comma sperated files for interleaved paired-end data sets
	Optional
	-k INT: kmer_length (<=32, default: 23)
	-od STRING: output_file_directory (default: ./)
	-t INT: number of threads to use (default: 1)
	-trim : allow trimming (default: false)
	-maxcorK INT: the maximum number of correction within k-bp window (default: 4)
	-wk FLOAT: the proportion of kmers that are used to estimate weak kmer count threshold, lower for more divergent genome (default: 0.95)
	-ek INT: expected number of kmers; does not affect the correctness of program but affects the memory usage (default: 100000000)
	-stdout: output the corrected reads to stdout (default: not used)
	-verbose: output some correction information to stdout (default: not used)
	-stage INT: start from which stage (default: 0)
		0-start from begining(storing kmers in bloom filter) ;
		1-start from count kmers showed up in bloom filter;
		2-start from dumping kmer counts into a jf_dump file;
		3-start from error correction.

Address of the bookmark: https://github.com/mourisl/Rcorrector/

Address of the bookmark: http://infoplatter.wordpress.com/2014/04/06/bioinformaticians-pocket-reference/