To address the challenges of describing and estimating virodiversity, a team of investigators from Center for Infection and Immunity (CII) and EcoHealth Alliance began in jungles of Bangladesh - home to the flying fox.

Reference:

http://economictimes.indiatimes.com/news/news-by-industry/et-cetera/mammals-harbour-at-least-320000-new-viruses/articleshow/22253268.cms

http://www.bbc.co.uk/news/science-environment-23932400

The image summarise all in one.

More at http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/C/Codons.html

WALK- IN –INTERVIEWS

Eligible candidates may appear in Walk-in-Interview on May 23, 2014 at 10 AM for the posts of Research Associates & Senior Research Fellows (SRF) in the following DST/DBT/ICAR funded projects.

1 NPTC Project on Bioinformatics and Comparative Genomics

Research Associate (One)

Rs. 24000/- + 30% HRA for masters degree holder with more than 4 years experience

Essential: Ph D in Plant Molecular Biology & Biotechnology/Genetics 0r Candidates who have already submitted their Ph D thesis in above subjects

Desirable: Research experience in Genomics, Molecular biology, Microarrays analysis, Gene cloning, transgenic Techniques , and computational analysis.

Senior Research Fellow ( UGCCSIR/ DBT/ ICAR Net qualified only): (One)

Rs. 16000/- + 30% HRA and Rs. 18000+30 HRA from 3rd year onwards

Essential:

1. ICAR/ UGCCSIR/DBT Net qualified only

2. M. Sc. (with thesis) in Biotechnology, Life Sciences, Biosciences/ Bioinformatics, Genetics/ Plant Pathology with experience in molecular biology.

Or M.Sc with more than 3 years research experiences

3. B.Sc. Agriculture or Biology

Desirable:
1. M. Sc. with thesis
2. Experience in molecular biology, plant tissue culture
3. Bioinformatics knowledge is important

2 DST JC Bose National Fellowship

Research Associate (Bioinformatics) : One

Rs.22000/- + 30% HRA for 1 & 2nd Yr., Rs. 23000+ 30% HRA for 3rd year and Rs. 24000+30% HRA for 4th &5th yr

Essential: M Ph D in Plant Molecular Biology & Biotechnology/Genetics

Desirable: Research experience in Genomics, Molecular biology, Microarrays analysis, Gene cloning, transgenic Techniques , and computational analysis.

Age limit: Max.35 years (Age relaxation of 5 years for SC/ST & women and 3 years for OBC)

The posts are purely temporary in nature and are co-terminus with the project. Initially the offer will be made for one year only and may be further extendable based on performance of the candidate. The interview will be held on May 23 , 2014 at 10:00 AM at NRCPB, LBS Building, Pusa Campus, IARI, New Delhi- 110012. The candidates must bring four copies of biodata (in the prescribed proforma), original certificates, attested photocopies of each of the certificates and an attested copy of recent passport size photograph. No. TA/DA would be given for the appearance in interview. Only the candidates having essential qualification would be entertained for the interviews. Short-listing of candidates based on academic merit and experience will be done in case of large number of applicants.

Advertisement: http://www.nrcpb.org/sites/default/files/Advertisement%20for%20RA%20and%20SRF%20Position.pdf

http://lin-group.cn/server/iRNAD/

Address of the bookmark: http://lin-group.cn/server/iRNAD/

C. Titus Brown http://video.open-bio.org/video/1/a-history-of-bioinformatics-in-the-year-2039

Address of the bookmark: http://huanglab.phys.hust.edu.cn/hnadock/

The Indian scientists working in Bangalore, along with their American counterparts, have mapped more than 17,000 proteins in 30 organs of the human body. Just like the human genome was sequenced around the turn of the millennium, this is an equivalent mapping of the human proteome.

The researcher estimated there are around 20,500 proteins in the human body. These scientists have profiled around 17,294, which account for around 84% of the total proteins. Apart from this, the team also traced around 2,500 of 3,000 proteins that had been categorised as "missing proteins".

The work, done by group of Indian scientists, and Johns Hopkins University, published in the renowned journal Nature ( http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html ). Of the 72 people who worked on the project, 46 are Indians.

Reference:

http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html

http://www.proteinatlas.org/ -The antibody-based Human Protein Atlas programme

http://www.humanproteomemap.org/ -Proteogenomic analysis by identifying translated proteins from annotated pseudogenes, non-coding RNAs and untranslated regions.

https://www.proteomicsdb.org/ -Assembled protein evidence for 18,097 genes in ProteomicsDB

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.