The image summarise all in one.

More at http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/C/Codons.html

The Indian scientists working in Bangalore, along with their American counterparts, have mapped more than 17,000 proteins in 30 organs of the human body. Just like the human genome was sequenced around the turn of the millennium, this is an equivalent mapping of the human proteome.

The researcher estimated there are around 20,500 proteins in the human body. These scientists have profiled around 17,294, which account for around 84% of the total proteins. Apart from this, the team also traced around 2,500 of 3,000 proteins that had been categorised as "missing proteins".

The work, done by group of Indian scientists, and Johns Hopkins University, published in the renowned journal Nature ( http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html ). Of the 72 people who worked on the project, 46 are Indians.

Reference:

http://www.nature.com/nature/journal/v509/n7502/full/nature13302.html

http://www.proteinatlas.org/ -The antibody-based Human Protein Atlas programme

http://www.humanproteomemap.org/ -Proteogenomic analysis by identifying translated proteins from annotated pseudogenes, non-coding RNAs and untranslated regions.

https://www.proteomicsdb.org/ -Assembled protein evidence for 18,097 genes in ProteomicsDB

http://lin-group.cn/server/iRNAD/

Address of the bookmark: http://lin-group.cn/server/iRNAD/

Address of the bookmark: http://huanglab.phys.hust.edu.cn/hnadock/

No.NITW/BT/2014/adhoc

APPLICATIONS ARE INVITED FOR THE APPOINTMENT OF ADHOC FACULTY ON CONTRACT BASIS IN THE DEAPARTMENT OF BIOTECHNOLOGY

Period of Contract: Initially the appointment is for one semester i.e., from July 2014 up to December 2014 only.

Essential Qualifications:

i) B. Tech or equivalent in Biotechnology/ Industrial Biotechnology/ Biochemical Engineering / Chemical Engg. Or M. Sc in Microbiology/ Botany/ Zoology/ Biochemistry/Biotechnology and ii) M. Tech or equivalent in Biotechnology/Industrial Biotechnology/Bioinformatics

Or

Integrated M. Tech in Biotechnology/Industrial Biotechnology/ Bioinformatics

Candidates must possess First class (60% aggregate marks or 6.5 CGPA) at B. Tech/ M. Sc and M. Tech.

Desirable: Ph. D Pay Package: All selected candidates shall be eligible for a consolidated pay of Rs.30, 000/- per month. Candidates with Ph. D shall be eligible for an additional amount of Rs.5, 000/- per month.

How to apply : Applications on plain paper with attested photocopies of certificate and bio data along with justification for eligibility should reach to the Head, Department of Biotechnology, National Institute of Technology, Warangal AP 506004 in the form of soft or hard copy on or before 21st June 2014 email : biotech_hod@nitw.ac.in

Intimation: No separate call letters will be sent to the candidates. All the eligible candidates will be notified in the institute web site on 23rd June 2014. All the eligible candidates are requested to report for the interview to the Head, Department of Biotechnology at 9:00 AM on 27th June 2014

Joining: Selected candidates will be informed and they are expected to join immediately.

Advertisement:

http://www.nitw.ac.in/nitw/announcements/2014/Bio-Adhoc%20Advt.%20May-2014.pdf

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Shell history search command

Type history at a shell prompt:
$ history

It will display the list of all used commandline history with an serial number.

To search particular command, enter:
$ history | grep command-name
$ history | egrep -i 'scp|ssh|ftp'
Emacs Line-Edit Mode Command History Searching

To get previous command containing string, hit [CTRL]+[r] followed by search string:

(reverse-i-search):

To get previous command, hit [CTRL]+[p]. You can also use up arrow key.

CTRL-p

To get next command, hit [CTRL]+[n]. You can also use down arrow key.

CTRL-n

fc command

Apart from hostory command there are fc command to extract the command from history. The fc stands for either "find command" or "fix command.

For example list last 10 command, enter:
$ fc -l 10
To list commands 130 through 150, enter:
$ fc -l 130 150
To list all commands since the last command beginning with ssh, enter:
$ fc -l ssh
You can edit commands 1 through 5 using vi text editor, enter:
$ fc -e vi 1 5

Delete command history

The -c option causes the history list to be cleared by deleting all of the entries:
$ history -c

First cover a full workflow from preparation, reads counting, data preprocessing, gene set test, to pathway visualization in about 40 lines of codes. The same workflow can be used for GO analysis or other types of gene set analysis too. We also describe joint workflows, i.e. to do gene-level analysis using one of the major RNA-Seq analysis tools, DEseq/DEseq2, edgeR, limma and Cufflinks, and feed the results into GAGE/Pahview for pathway analysis or visualization. All these workflows are implemented in R/Bioconductor.

The work ows cover the most common situations and issues for RNA-Seq data pathway analysis. Issues like data quality assessment are relevant for data analysis in general yet out the scope of this tutorial. Although we focus on RNA-Seq data here, but pathway analysis work ow remains similar for microarray, particularly step 3-4 would be the same. Please check gage and pathview vigenttes for details.

Note: You need to update to current release versions of R(3.0.2)/ Bioconductor(2.13) to use all the features. 

Reference: 

Please check it out:
http://bioconductor.org/packages/release/bioc/html/gage.html
http://bioconductor.org/packages/release/bioc/vignettes/gage/inst/doc/RNA-seqWorkflow.pdf