The standalone version (Linux-based command-line) of RNAcon is freely available for the global scientific community.

Reference: Panwar, B.; Arora, A. and Raghava, G.P.S. (2014) Prediction and classification of ncRNAs using structural informationBMC Genomics 2014, 15:127

Address of the bookmark: http://crdd.osdd.net/raghava/rnacon/

Webpage : https://www.scilifelab.se/about-us/
Opportunity: https://www.scilifelab.se/about-us/career/

Address of the bookmark: https://github.com/dutilh/CAT

Walk- in- Test cum Interview (based on test) for the selection of Research Associate

under the scheme “Distributed Information Sub Centre –DISC” & Research Assistant under scheme “Phytophthora, Fusarium and Ralstonia diseases of Horticultural and Field Crops” will be held at this Institute as per details indicated below.

WALK -IN- TEST CUM INTERVIEW

Name of the post : Research Associate

Date of Interview : 21-05-2014 at 10.00 AM

No. of posts : One

Qualifications : a)Essential

Ph.D Degree in Bioinformatics OR : Masters degree in Bioinformatics with a minimum of
60% marks or equivalent OGPA with at least two years research experience as evidenced from fellowship/ associateship/training/published papers etc.

b)Desirable: Experience in NGS data analysis.

Emoluments : Rs. 23,000/- per month + HRA (Masters Degree Holders)

Rs. 24,000/- per month + HRA (Ph.D Degree Holders)

Upper age limit : 40 years for Men & 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)

Duration of Project : Till 31-03-2017.

Title of Assigment : Research Assistant (on contract basis)

No. of vacancy : One

Qualification : Essential : Post Graduation in Bioinformatics and Minimum one year experience in NGS data analysis

Desirable : Experience in Perl/Python/R

Remuneration : Rs. 20,000/- per month (consolidated)

Scope of work :

1. Analysis of different file formats and their conversions.

2. Assessing the quality of data and filtering of raw reads.
3. Assembling the raw reads-de novo as well as reference mapping.
4. Compression of aligned reads using Jam tools
5. RNA-seq. Analysis
6. Differential expression testing involving Normalization, Statistical testing, heat map generation & hierarchical clustering
7. Annotating the assembled genome and geneet testing and their validation
8. Metabolic pathway analysis
9. Comparative genomics
10. Setting up of genome browsers.

Period of Assigment : Initially for six months.

Date & Venue of Interview : 21-05-2014 at IISR, Kozhikode at 10.00 AM

More at http://www.spices.res.in/pdf/disc-advtmnt.pdf

Chettinad Academy of Research and Education (CARE) invites applications from eligible and translational research-oriented candidates to the posts of Professor/Associate Professor/ Assistant Professor Computational Biology, Bioinformatics, and Pharmaceutical Chemistry.

Emoluments: As per UGC norms (Adequate Compensation for Postdoctoral/Teaching experience)

Candidates fulfilling the eligibility criteria as per the UGC norms can send their full CV with copies of certificates and reference letters to the following address by post or by e-mail on or before 31st May 2014

The Registrar,
Chettinad Academy of Research and Education,
Chettinad Health City
Kelambakkam, Chennai 603 103
Tamil Nadu
T +91 (0)44 4741 1000
F +91 (0)44 4741 1011
Email: jobs @chettinadhealthcity.com

Advertisement: http://182.73.176.163/chc/ads2014.pdf

https://dengue-lineages.org/

Address of the bookmark: https://dengue-lineages.org/

http://www.eva.mpg.de/genetics/bioinformatics/overview.html?Fsize=0%2C%20%40%2F%27

Kelso Group
Department of Evolutionary Genetics
Max Planck Institute for Evolutionary Anthropology
Deutscher Platz 6
04103 Leipzig
Germany
Phone: +49 341 3550 500

Job:
http://www.eva.mpg.de/genetics/bioinformatics/jobs.html?Fsize=0%2C%2B%40

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

Tasks:  239 total,   1 running,  238 sleeping,   0 stopped,   0 zombie

This line tells you how many processes are running. If you are using laptops machines it’s not so interesting because you really are the only one using this machine.

Cpu(s):  0.0%us,  0.0%sy,  0.0%ni,100.0%id,  0.0%wa,  0.0%hi,  0.0%si,  0.0%st

This line contains the CPU load. The first two numbers are how busy the system is doing computation (“us” stands for “user”) and how busy the system is doing system-y things like accessing disks or network (“sy” stands for “system”). We’ll talk more about this later.

Mem:   49457320k total,    3492174k used,  14535596k free,    1435148k buffers

This should be easy to understand – how much memory you’re using!

Swap:   539356k total,   28332k used,   836562k free,    29862014k cached

Swap is just on-disk memory that can be used to “swap” out programs from main memory. Again, we’ll talk about this later.:

PID USER      PR  NI  VIRT  RES  SHR S %CPU %MEM    TIME+  COMMAND
  1 root      39   19  0  0  0 S  0.0  0.0   246:57.22 kipmi0
  2 root      RT   0     0    0    0 S  0.0  0.0   0:00.00 migration/0

And... finally! What’s actually running! The two most important numbers are the %CPU and %MEM towards the right, as well as the COMMAND. This tells you how compute- and memory-intensive your program is. Right now, nothing’s running so the numbers aren’t very interesting, but just wait until we run something...