Why Bioinformatics Matters More Than Ever

Every day, our world generates massive amounts of biological data—from genome sequences to microbiome profiles to real-time pathogen surveillance. Hidden within these datasets are the answers to some of the greatest challenges humanity faces: emerging diseases, antimicrobial resistance, environmental stress, genetic disorders, sustainable agriculture, and more.

Bioinformatics isn’t just a skill.
It’s the language of the future of biology.

By mastering it, you give yourself the power to:

Decode genomes and understand life at its most fundamental level

Identify patterns no microscope could ever reveal

Predict disease outbreaks before they occur

Accelerate drug discovery with computational precision

Contribute to open-source tools that empower scientists worldwide

You don’t just follow science—you drive it.

Every Expert Was Once a Beginner

Many newcomers feel intimidated. Command-line interfaces. R scripts. Python packages. Next-generation sequencing data. Complex machine learning models.

But here’s the truth: every bioinformatician started exactly where you are now—curious, unsure, but excited.

No one writes perfect code on day one.

No one understands genomics pipelines immediately.

What makes you a bioinformatician is not perfection, but perseverance.

When your script throws a cryptic error…
When your data refuses to format…
When your pipeline runs for 6 hours only to crash…

Remember: this is part of the journey.
Every error teaches you. Every retry strengthens you. Every breakthrough energizes you.

Bioinformatics Is Not Just a Career—It’s a Mindset

It’s the mindset of:

Problem-solving.

Continuous learning.

Turning chaos into clarity.

Seeing what others can’t.

Bioinformaticians are detectives of biological complexity. You sit at the intersection of innovation, using tools that can shape public health, medicine, agriculture, and ecology. Few fields give you such direct impact on the world.

Your Contribution Matters

As you work on your script, pipeline, genome, or model, remember:

Somewhere, your analysis might contribute to:

A new therapy

A faster diagnostic test

A better understanding of a pathogen

A more resilient crop

An open-source dataset that helps thousands

A discovery that rewrites textbooks

Your code may be small, but its ripple effect is powerful.

The Future Is Bioinformatics—And You Are Part of It

The world is shifting. Wet labs are integrating AI. Hospitals rely on genomic insights. Farmers use gene-level predictions. Governments monitor disease in real time. Students launch pipelines that become global tools.

This is a golden era—and you are not late.
You are exactly where you need to be.

Keep Pushing. Keep Learning. Keep Discovering.

Bioinformatics is a journey filled with challenges, but also with unmatched rewards.

So the next time you feel stuck, frustrated, or overwhelmed, remember:
You’re building the science of tomorrow.

Be proud. Stay curious. Keep going.
Your work matters more than you think.

The Job detail

Advancing the SNP-discovery and polymorphism assessment work across several germplasm panels representing global genetic diversity
Population genetic and genomic analyses, testing the hypothesis related to adaptation in multiple geographic regions
Develop SNP assays from large scale GBS and other re-sequencing data for several target traits utilizing available phenotyping data
Combined analyses of genotypic and phenotypic data for discovery of marker-trait associations, and conducting GWAS
Processing, analyzing, and archiving large-scale genomic data sets, assessing data quality, conducting analyses, interpreting findings, and communicating findings to others including preparation of reports, presentations, posters and journal articles
Providing support to MSc and PhD students on topic related to its major core of research
Any other work assigned by the supervisor

The Person:

PhD in bioinformatics, genetics, computational biology preferably with 1 to 2 years of experience;
familiar with standard bioinformatics tools and scripting languages and emerging and evolving software platforms relevant to bioinformatics and computational biology;
ability to create new analytical pipelines; experience with handling large data sets;
ability to program in at least two of the following: C++, PERL, Python, R, Java.
will use next-generation sequencing technologies to generate marker data for genetic mapping and transcriptome data for expression QTL mapping, and will be responsible for data generation as well as data analysis.

Period and Remuneration: The assignment is for a period of two years, and can be extended for another year depending on performance. ICRISAT pays a very attractive all inclusive lump sum assignment fee payable in Indian Rupees.

How to Apply: Please send your application by email to icrisatjobs@cgiar.org, stating the job title (Special project Scientist-Sorghum Genomics) clearly in the subject column, addressed to the Director, Human Resources and Operations, ICRISAT, Patancheru, Andhra Pradesh 502 324, India, latest by 10 June 2014. The application should include an up-to-date Curriculum Vitae, a short statement of competencies and experience for the position, and the names and addresses (including phone/e-mail) of three referees. Only short-listed candidates will be contacted.

More at: http://www.icrisat.org/careers/Special-Project-Scientist-Sorghum-Genomics.htm

The standalone version (Linux-based command-line) of RNAcon is freely available for the global scientific community.

Reference: Panwar, B.; Arora, A. and Raghava, G.P.S. (2014) Prediction and classification of ncRNAs using structural informationBMC Genomics 2014, 15:127

Address of the bookmark: http://crdd.osdd.net/raghava/rnacon/

Webpage : https://www.scilifelab.se/about-us/
Opportunity: https://www.scilifelab.se/about-us/career/

Address of the bookmark: https://github.com/dutilh/CAT

Walk- in- Test cum Interview (based on test) for the selection of Research Associate

under the scheme “Distributed Information Sub Centre –DISC” & Research Assistant under scheme “Phytophthora, Fusarium and Ralstonia diseases of Horticultural and Field Crops” will be held at this Institute as per details indicated below.

WALK -IN- TEST CUM INTERVIEW

Name of the post : Research Associate

Date of Interview : 21-05-2014 at 10.00 AM

No. of posts : One

Qualifications : a)Essential

Ph.D Degree in Bioinformatics OR : Masters degree in Bioinformatics with a minimum of
60% marks or equivalent OGPA with at least two years research experience as evidenced from fellowship/ associateship/training/published papers etc.

b)Desirable: Experience in NGS data analysis.

Emoluments : Rs. 23,000/- per month + HRA (Masters Degree Holders)

Rs. 24,000/- per month + HRA (Ph.D Degree Holders)

Upper age limit : 40 years for Men & 45 years for Women as on date of Interview (Upper Age limits are relaxable for SC, ST and OBC candidates as per Govt. of India norms (at present 5 years for SC/ST and 3 years for OBC)

Duration of Project : Till 31-03-2017.

Title of Assigment : Research Assistant (on contract basis)

No. of vacancy : One

Qualification : Essential : Post Graduation in Bioinformatics and Minimum one year experience in NGS data analysis

Desirable : Experience in Perl/Python/R

Remuneration : Rs. 20,000/- per month (consolidated)

Scope of work :

1. Analysis of different file formats and their conversions.

2. Assessing the quality of data and filtering of raw reads.
3. Assembling the raw reads-de novo as well as reference mapping.
4. Compression of aligned reads using Jam tools
5. RNA-seq. Analysis
6. Differential expression testing involving Normalization, Statistical testing, heat map generation & hierarchical clustering
7. Annotating the assembled genome and geneet testing and their validation
8. Metabolic pathway analysis
9. Comparative genomics
10. Setting up of genome browsers.

Period of Assigment : Initially for six months.

Date & Venue of Interview : 21-05-2014 at IISR, Kozhikode at 10.00 AM

More at http://www.spices.res.in/pdf/disc-advtmnt.pdf

Chettinad Academy of Research and Education (CARE) invites applications from eligible and translational research-oriented candidates to the posts of Professor/Associate Professor/ Assistant Professor Computational Biology, Bioinformatics, and Pharmaceutical Chemistry.

Emoluments: As per UGC norms (Adequate Compensation for Postdoctoral/Teaching experience)

Candidates fulfilling the eligibility criteria as per the UGC norms can send their full CV with copies of certificates and reference letters to the following address by post or by e-mail on or before 31st May 2014

The Registrar,
Chettinad Academy of Research and Education,
Chettinad Health City
Kelambakkam, Chennai 603 103
Tamil Nadu
T +91 (0)44 4741 1000
F +91 (0)44 4741 1011
Email: jobs @chettinadhealthcity.com

Advertisement: http://182.73.176.163/chc/ads2014.pdf

https://dengue-lineages.org/

Address of the bookmark: https://dengue-lineages.org/

http://www.eva.mpg.de/genetics/bioinformatics/overview.html?Fsize=0%2C%20%40%2F%27

Kelso Group
Department of Evolutionary Genetics
Max Planck Institute for Evolutionary Anthropology
Deutscher Platz 6
04103 Leipzig
Germany
Phone: +49 341 3550 500

Job:
http://www.eva.mpg.de/genetics/bioinformatics/jobs.html?Fsize=0%2C%2B%40

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!