Applications are invited for the position of Senior Research Fellow for the following time-bound sponsored project as per the details given below:

1. BTIS project on, “Bioinformatics Center-National Infrastructural Facility in the Area of Immunology” funded by DBT

Senior Research Fellow (P) (One Position only)

Dr. Debasisa Mohanty
Staff Scientist-VI
deb@nii.res.in

Qualifications: M.Sc in Biological Sciences or Biotechnology with at least 04 years of Research experience in Bioinformatics or computational Biology after the master’s degree is essential.

Emoluments: The selected candidates will draw consolidated emoluments as per Institute Rules, depending upon qualifications & experience

Rs. 18,000/- per month consolidated plus 30% HRA if Leading to Ph.D/NET/GATE Qualified otherwise Rs. 14,000/- per month + 30% HRA.

Job description: The candidate should be well versed in programming in PERL/C++/HTML/CGI, web server and portal development, computational analysis of
protein structure & function, molecular dynamics simulations and use of high performance computing systems.

GENERAL TERMS AND CONDITIONS:-

1. The candidates selected for the above posts will be on contract for one year or duration of the project whichever is shorter, at a time.
2. No hostel/ housing facility will be provided.
3. Number of posts may vary and shall be need based. Advertisement is no commitment.
4. Applicants may clearly mention the category they belong to i.e. SC/ST/OBC/PH and attach documentary proof of the same.
5. No TA/DA will be paid for attending the interview, if called for.
6. Apart from sending application in the prescribed format given below, candidates should send complete Curriculum Vitae along with the names of three referees. Curriculum Vitae should contain details of the experimental expertise.

HOW TO APPLY Interested candidates may apply directly, STRICTLY IN THE PRESCRIBED FORMAT GIVEN BELOW, through e-mail, to the Investigator of the project, clearly indicating the name of the project along with their complete C.V., e-mail id, fax numbers, telephone numbers. Only Short listed candidates will be called for interview and they required to submit attested copies of all their certificates and a Demand Draft of Rs 100/- drawn on Canara Bank or Indian Bank payable at Delhi/New Delhi in favour of the Director, NII (SC / ST and PH candidates are exempted subject to submission of documentary proof), at the time of interview.

LAST DATE OF RECEIPT OF APPLICATIONS: 06th June, 2014

Advertisement

www1.nii.res.in/sites/default/files/projectappointment-Dr.Mohanty-6June2014.pdf

Find the detail of the reads repeats:

fq2fa ONT_A.fastq ONT_A.fasta 

minimap2 -xava-ont ONT_A.fasta ONT_A.fasta -t10 -X > AONT.paf 

awk '{if($1==$6){print}}' AONT.paf > AONTself.paf 

awk '$5=="-"' AONTself.paf | awk '{print $1}'| sort|uniq > invertedrepeat.list

Generated a few palindrome and repeats plots (highlighting only repeats largest than 10, 20 and 30 kb)

minidot -f 5 -m 30000 AONTself.paf > AONTself30000.eps 
sed 's/_template_pass_FAH31515//' AONTself30000.eps > AONTself30000final.eps 

minidot -f 5 -m 20000 AONTself.paf > AONTself20000.eps 
sed 's/_template_pass_FAH31515//' AONTself20000.eps > AONTself20000final.eps 

minidot -f 5 -m 10000 AONTself.paf > AONTself10000.eps 
sed 's/_template_pass_FAH31515//' AONTself10000.eps > AONTself10000final.eps 

Assemble with miniasm:

miniasm -f ONT_A.fasta AONT.paf > AONT.gfa 

grep '^S' AONT.gfa |awk '{print ">"$2"\n"$3}' > AONT_miniasm.fasta 

minimap2 -xasm10 AONT_miniasm.fasta AONT_miniasm.fasta -t1 -X > AONT_miniasm.paf 

awk '{if($1==$6){print}}' AONT_miniasm.paf > AONT_miniasm_self.paf 

minidot -f 5 -m 10000 AONT_miniasm_self.paf > AONT_miniasm_self10000.eps 

Njoy the assembly !

Candidates should have a 1st class MSc/MTech/BTech degree in Bioinformatics. Please send complete CV, quoting Application for RMETH-JRF-2014, by email to Dr. Dinesh Gupta: dinesh@icgeb.res.in

Closing date for applications: 6 August 2014

More at http://www.icgeb.org/tl_files/Vacancies/JRF.pdf

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

sort a space-delimited file based on its first column, then the second if the first is the same, and so on:
sort input.txt

sort a huge file (GNU sort ONLY):
sort -S 1500M -t $HOME/tmp input.txt > sorted.txt

sort starting from the third column, skipping the first two columns:
sort +2 input.txt

sort the second column as numbers, descending order; if identical, sort the 3rd as strings, ascending order:
sort -k2,2nr -k3,3 input.txt

sort starting from the 4th character at column 2, as numbers:
sort -k2.4n input.txt

More Linxu sort command information

If you have any sort commands you'd like to share, please add them to our comments section below. For more help, you can also type:

man sort

or

sort --help

on your Unix/Linux system.

Biostrings

The Biostrings package from Bioconductor provides an advanced environment for efficient sequence management and analysis in R. It contains many speed and memory effective string containers, string matching algorithms, and other utilities, for fast manipulation of large sets of biological sequences. The objects and functions provided by Biostrings form the basis for many other sequence analysis packages. Documentation

The work will focus on the functional studies of small RNAs by using next-generation sequencing approaches.

Candidates should hold a Ph.D. degree and have strong background in bioinformatics.
The University of Nice Sophia-Antipolis provides a wide range of facilities and training essential for biomedical research.

Interested applicants should send a PDF with a cover letter stating research interests and qualifications, an updated CV, a summary of previous research experience and contact information for two references to Michele Trabucchi ( mtrabucchi@unice.fr )

Homepage: http://www.unice.fr/c3m/EN/Equipe10.html

Address of the bookmark: http://www.gigasciencejournal.com/content/2/1/15?utm_content=buffer25ee0&utm_medium=social&utm_source=twitter.com&utm_campaign=buffer

De Bruijn Graphs for NGS Assembly
Algorithms for PacBio Reads
Software and Hardware Concepts for Bioinformatics
Finding us in Homolog.us (Search Algorithms)
NGS Genome and RNAseq Assembly - a Hands on Primer
Introduction to PERL, Python, R and C/C++ for Bioinformatics

Address of the bookmark: http://www.homolog.us/Tutorials/