<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44720?offset=830</link>
	<atom:link href="https://bioinformaticsonline.com/related/44720?offset=830" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11313/linux-sort-commands-for-bioinformatics</guid>
	<pubDate>Sat, 31 May 2014 15:41:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11313/linux-sort-commands-for-bioinformatics</link>
	<title><![CDATA[Linux Sort Commands for Bioinformatics]]></title>
	<description><![CDATA[<p>Almost all the scripting languages such as Perl, Python etc have built-in sort, but unfortunately none of them are as flexible as sort command. But one when it come to space efficiency GNU sort stands at the top. It can sort a 20Gb file with less than 2Gb memory. It is not trivial to implement so powerful a sort by yourself.</p><p>sort a space-delimited file based on its first column, then the second if the first is the same, and so on:<br />sort input.txt</p><p>sort a huge file (GNU sort ONLY):<br />sort -S 1500M -t $HOME/tmp input.txt &gt; sorted.txt</p><p>sort starting from the third column, skipping the first two columns:<br />sort +2 input.txt</p><p>sort the second column as numbers, descending order; if identical, sort the 3rd as strings, ascending order:<br />sort -k2,2nr -k3,3 input.txt</p><p>sort starting from the 4th character at column 2, as numbers:<br />sort -k2.4n input.txt</p><p>More Linxu sort command information<br /><br />If you have any sort commands you'd like to share, please add them to our comments section below. For more help, you can also type:<br /><br />man sort<br /><br />or<br /><br />sort --help<br /><br />on your Unix/Linux system.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11399/next-generation-sequencing-in-r-or-bioconductor-environment</guid>
	<pubDate>Mon, 02 Jun 2014 18:03:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11399/next-generation-sequencing-in-r-or-bioconductor-environment</link>
	<title><![CDATA[Next generation sequencing in R or bioconductor environment]]></title>
	<description><![CDATA[<p>There are many R software and bioconductor packages for NGS data analysis, some of them are as follows</p><h3><a name="TOC-Biostrings" id="TOC-Biostrings"></a>Biostrings</h3><p>The Biostrings package from Bioconductor provides an advanced environment for efficient sequence management and analysis in R. It contains many speed and memory effective string containers, string matching algorithms, and other utilities, for fast manipulation of large sets of biological sequences. The objects and functions provided by Biostrings form the basis for many other sequence analysis packages. <a href="http://bioconductor.org/packages/release/bioc/html/Biostrings.html">Documentation</a></p><div><div style="text-align: left;"><div style="color: #000000;"><h4><a name="TOC-IRanges-Overview" id="TOC-IRanges-Overview"></a>IRanges Overview</h4><p>IRanges provides the low-level infrastructure and containers for handling sets of integer ranges within Bioconductor's BioC-Seq domain. Its classes and methods provide support for many more high-level packages like GenomicRanges, ShortRead, Rsamtools, etc. <a href="http://bioconductor.org/packages/release/bioc/html/IRanges.html">Documentation</a></p><div style="text-align: right;"><div style="text-align: left;"><h4><a name="TOC-GenomicRanges-Overview" id="TOC-GenomicRanges-Overview"></a>GenomicRanges Overview</h4><p>The <em>GenomicRanges</em> package serves as the foundation for representing genomic locations within the Bioconductor project. It is built upon the <em>IRanges</em> infrastructure and defines three major data containers - <em>GRanges, GRangesList</em> and <em>GappedAlignments</em> - which are supporting other important BioC-Seq packages including <em>ShortRead, Rsamtools, rtracklayer, GenomicFeatures</em> and <em>BSgenome</em>.&nbsp; Compared to the IRanges container, the GRanges/<em>GRangesList</em> classes are more flexible and extensible to store additional information about sequence ranges, such as chromosome identifiers (sequence space), strand information and annotation data. <a href="http://bioconductor.org/packages/release/bioc/html/GenomicRanges.html">Documentation</a></p></div></div></div></div><h3><a name="TOC-Motif-Discovery" id="TOC-Motif-Discovery"></a>Motif Discovery</h3><h4><a name="TOC-cosmo" id="TOC-cosmo"></a>cosmo</h4><p>The cosmo package allows to search a set of unaligned DNA sequences for a shared motif that may function as transcription factor binding site. The algorithm extends the popular motif discovery tool MEME (Bailey and Elkan, 1995) in that it allows the search to be supervised by specifying a set of constraints that the motif to be discovered must satisfy. <a href="http://bioconductor.org/packages/release/bioc/html/cosmo.html">Documentation</a></p></div><div>
<p><span></span><span></span></p>
<div style="color: #0000ff;"><h4><a name="TOC-BCRANK" id="TOC-BCRANK"></a>BCRANK</h4><p>BCRANK is a method that takes a ranked list of genomic regions as input and outputs short DNA sequences that are overrepresented in some part of the list. The algorithm was developed for detecting transcription factor (TF) binding sites in a large number of enriched regions from high-throughput ChIP-chip or ChIP-seq experiments, but it can be applied to any ranked list of DNA sequences. Documentation</p>
<p><a href="http://bioconductor.org/packages/release/bioc/html/BCRANK.html"></a></p>
<p>rGADEM: <a href="http://bioconductor.org/packages/devel/bioc/html/rGADEM.html">Documentation</a></p><p>MotIV: <a href="http://bioconductor.org/packages/devel/bioc/html/MotIV.html">Documentation</a></p></div><h3><a name="TOC-ShortRead" id="TOC-ShortRead"></a>ShortRead</h3><p>The ShortRead package provides input, quality control, filtering, parsing, and manipulation functionality for short read sequences produced by high throughput sequencing technologies. While support is provided for many sequencing technologies, this package is primairly focused on Solexa/Illumina reads. <a href="http://bioconductor.org/packages/release/bioc/html/ShortRead.html">Documentation</a></p><h3><a name="TOC-Rsamtools" id="TOC-Rsamtools"></a>Rsamtools</h3><p>Rsamtools provides functions for parsing and inspecting samtools BAM formatted binary alignment data. SAM/BAM is quickly becoming a universal standard alignment format, and is now supported by a wide variety of alignment tools. <a href="http://bioconductor.org/help/bioc-views/2.7/bioc/html/Rsamtools.html">Documentation</a></p>
<p><a href="http://samtools.sourceforge.net/">Samtools Website</a><br /> <a href="http://bio-bwa.sourceforge.net/">BWA (Burrows-Wheeler Alignment) Website</a><br /><span style="color: #0000ff;"></span></p>
<div style="color: #000000;">&nbsp;</div></div><div>
<p><span style="color: #000000;">Additional tools for SNP analysis:&nbsp;</span></p>
<p><a href="http://bioconductor.org/help/bioc-views/release/bioc/html/snpMatrix.html">snpMatrix</a></p><h3><a name="TOC-BSgenome" id="TOC-BSgenome"></a>BSgenome</h3><p>BSgenome provides an object oriented infrastructure for interacting with a Biostring based genome sequence. BSgenome packages exist for many common genomes, and can be created to represent custom genomes. See the "How to forge a BSgenome data package" Vignette for instructions to create a new BSgenome package if a prebuilt package does not exist for your organism. <a href="http://bioconductor.org/packages/release/bioc/html/BSgenome.html">Documentation</a></p><h3><a name="TOC-rtracklayer" id="TOC-rtracklayer"></a>rtracklayer</h3><p>rtracklayer provides an interface for exporting annotation feature data to various genome browsers and file formats (such as GFF). See the Small RNA Profiling exercise for an example of using rtracklayer to visualize alignment coverage. <a href="http://bioconductor.org/packages/release/bioc/html/rtracklayer.html">Documentation</a></p><h3><a name="TOC-biomaRt" id="TOC-biomaRt"></a>biomaRt</h3><p>The biomaRt package, provides an interface to a growing collection of databases implementing the BioMart software suite (http:// www.biomart.org). The package enables online retrieval of large amounts of data in a uniform way without the need to know the underlying database schemas. This data is retrieved automatically via the Internet, so it's recommended that you cache the data locally, or check versions if your code will be adversely affected by updates to these data. <a href="http://bioconductor.org/packages/release/bioc/html/biomaRt.html">Documentation</a></p><h3><a name="TOC-ChIP-Seq-Analysis-Packages" id="TOC-ChIP-Seq-Analysis-Packages"></a>ChIP-Seq Analysis Packages</h3><p>Bioconductor provides various packages for analyzing and visualizing ChIP-Seq data. Only a small selection of these packages is introduced here. Additional useful introductions to this topic are: <a href="http://www.bioconductor.org/workshops/2009/SeattleJan09/ChIP-seq/">BioC ChIP-seq Case Study</a> and BioC <a href="http://www.bioconductor.org/help/course-materials/2009/SeattleNov09/ChIP-seq/">ChIP-Seq</a>.</p><h4><a name="TOC-chipseq" id="TOC-chipseq"></a>chipseq</h4><p>The chipseq package combines a variety of HT-Seq packages to a pipeline for ChIP-Seq data analysis. <a href="http://bioconductor.org/packages/release/bioc/html/chipseq.html">Documentation</a></p><h4><a name="TOC-BayesPeak" id="TOC-BayesPeak"></a>BayesPeak</h4><p>BayesPeak is a peak calling package for identifying DNA binding sites of proteins in ChIP-Seq experiments. Its algorithm uses hidden Markov models (HMM) and Bayesian statistical methods. The following sample code introduces the identification of peaks with the BayesPeak package as well as the incorporation of read coverage information obtained by the chipseq package. <a href="http://bioconductor.org/packages/release/bioc/html/BayesPeak.html">Documentation</a> [ <a href="http://www.biomedcentral.com/1471-2105/10/299">Publication</a> ]</p><h4><a name="TOC-PICS" id="TOC-PICS"></a>PICS</h4><p>The PICS package applies probabilistic inference to aligned-read ChIP-Seq data in order to identify regions bound by transcription factors. PICS identifies enriched regions by modeling local concentrations of directional reads, and uses DNA fragment length prior information to discriminate closely adjacent binding events via a Bayesian hierarchical t-mixture model. The following sample code uses the test data set from the above BayesPeak package in order to compare the results from both methods by identifying their consensus peak set. <a href="http://www.bioconductor.org/packages/release/bioc/html/PICS.html">Documentation</a> [ <a href="http://www.hubmed.org/display.cgi?uids=20528864">Publication</a> ]</p><h4><a name="TOC-ChIPpeakAnno" id="TOC-ChIPpeakAnno"></a>ChIPpeakAnno</h4><p>The ChIPpeakAnno package provides. batch annotation of the peaks identified from either ChIP-seq or ChIP-chip experiments. It includes functions to retrieve the sequences around peaks, obtain enriched Gene Ontology (GO) terms, find the nearest gene, exon, miRNA or custom features such as most conserved elements and other transcription factor binding sites supplied by users. The package leverages the biomaRt, IRanges, Biostrings, BSgenome, GO.db, multtest and stat packages. <a href="http://bioconductor.org/packages/release/bioc/html/ChIPpeakAnno.html">Documentation</a></p><h4><a name="TOC-Additional-ChIP-Seq-Packages" id="TOC-Additional-ChIP-Seq-Packages"></a>Additional ChIP-Seq Packages</h4><p>DiffBind: <a href="http://www.bioconductor.org/packages/release/bioc/html/DiffBind.html">Documentation</a></p><p>MOSAICS: <a href="http://bioconductor.org/packages/devel/bioc/html/mosaics.html">Documentation</a></p><p>iSeq: <a href="http://bioconductor.org/packages/release/bioc/html/iSeq.html">Documentation</a></p><p>ChIPseqR: <a href="http://bioconductor.org/packages/release/bioc/html/ChIPseqR.html">Documentation</a></p><p>ChiPsim: <a href="http://bioconductor.org/packages/release/bioc/html/ChIPsim.html">Documentation</a></p><p>CSAR: <a href="http://www.bioconductor.org/packages/devel/bioc/html/CSAR.html">Documentation</a></p><p>ChIP-Seq Pipeline: <a href="http://www.bioconductor.org/packages/release/bioc/html/PICS.html">PICS</a>, rGADEM and MotIV (<a href="http://www.rglab.org/pics-and-bioconductor/">developer web site</a>)</p><p>SPP: <a href="http://compbio.med.harvard.edu/Supplements/ChIP-seq/">ChIP-seq processing pipeline</a></p><p><a href="http://compbio.med.harvard.edu/Supplements/ChIP-seq/tutorial.html">SPP Tutorial</a></p><p><a href="http://liulab.dfci.harvard.edu/MACS/index.html">MACS</a></p><p><a href="http://gmdd.shgmo.org/Computational-Biology/ChIP-Seq/download/SIPeS">SIPeS</a></p><h3><a name="TOC-RNA-Seq-Analysis" id="TOC-RNA-Seq-Analysis"></a>RNA-Seq Analysis</h3><h4><a name="TOC-Counting-Reads-that-Overlap-with-Annotation-Ranges-" id="TOC-Counting-Reads-that-Overlap-with-Annotation-Ranges-"></a>Counting Reads that Overlap with Annotation Ranges&nbsp;</h4><p>The GenomicRanges package provides support for importing into R short read alignment data in BAM format (via Rsamtools) and associating them with genomic feature ranges, such as exons or genes. This way one can quantify the number of reads aligning to annotated genomic regions. The package defines general purpose containers for storing genomic intervals as well as more specialized containers for storing alignments against a reference genome. The two main functions for read counting provided by this infrastructure are <span>countOverlaps <span style="color: #000000;"><span>and</span></span> summarizeOverlaps</span>. For their proper usage, it is important to read the corresponding <a href="http://www.bioconductor.org/packages/devel/bioc/vignettes/GenomicRanges/inst/doc/summarizeOverlaps.pdf">PDF manual</a>. <a href="http://bioconductor.org/packages/release/bioc/html/GenomicRanges.html">Documentation</a></p><h4><a name="TOC-Differential-Gene-Expression-Analysis-with-DESeq" id="TOC-Differential-Gene-Expression-Analysis-with-DESeq"></a>Differential Gene Expression Analysis with DESeq</h4><p>The DESeq package contains functions to call differentially expressed genes (DEGs) in count tables based on a model using the negative binomial distribution. It expects as input a data frame with the raw read counts per region/gene of interest (rows) for each test sample (columns).&nbsp; Such a count table can be imported into R or generated from BAM alignment files using the <span>countOverlaps</span> function as introduced above. <a href="http://www.bioconductor.org/packages/release/bioc/html/DESeq.html">Documentation</a></p><h4><a name="TOC-Differential-Gene-Expression-Analysis-with-edgeR" id="TOC-Differential-Gene-Expression-Analysis-with-edgeR"></a>Differential Gene Expression Analysis with edgeR</h4><p>The edgeR package uses empirical Bayes estimation and exact tests based on the negative binomial distribution to call differentially expressed genes (DEGs) in count data.&nbsp;</p>
<p><a href="http://www.bioconductor.org/packages/release/bioc/html/edgeR.html">Documentation</a></p>
<p><span style="color: #000000;">A variety of additional R packages are available for normalizing RNA-Seq read count data and identifying differentially expressed genes (DEG): <br /> </span></p><p><a href="http://bioconductor.org/packages/devel/bioc/html/easyRNASeq.html">easyRNASeq</a> (simplifies read counting per genome feature)</p><p><a href="http://www.bioconductor.org/packages/release/bioc/html/DEXSeq.html">DEXSeq</a> (Inference of differential exon usage);&nbsp;<a href="http://www.bioconductor.org/packages/release/data/experiment/html/parathyroidSE.html">parathyroidSE</a> explains how to generate exon read counts in R</p><p><a href="http://bioconductor.org/packages/release/bioc/html/DEGseq.html">DEGseq</a></p><p><a href="http://www.bioconductor.org/packages/release/bioc/html/baySeq.html">baySeq</a> (also see: <a href="http://www.bioconductor.org/packages/release/bioc/html/segmentSeq.html">segmentSeq</a>)</p><p><a href="http://bioconductor.org/packages/release/bioc/html/Genominator.html">Genominator</a> (<a href="http://www.hubmed.org/display.cgi?uids=20167110">Bullard et al. 2010</a>)</p><div style="text-align: right;"><div style="text-align: left;"><h4><a name="TOC-Detection-of-Alternative-Splice-Junctions" id="TOC-Detection-of-Alternative-Splice-Junctions"></a>Detection of Alternative Splice Junctions</h4>
<p><span style="color: #000000;">Another utility of RNA-Seq experiments is the analysis of splice junctions. The following software suggestions provide this utility:</span></p>
<p><a href="http://woldlab.caltech.edu/rnaseq/">ERANGE<br /> </a><a href="http://tophat.cbcb.umd.edu/">TopHat</a></p><p><a href="http://biogibbs.stanford.edu/%7Ekinfai/SpliceMap/">SpliceMap</a></p><p><a href="http://solidsoftwaretools.com/gf/project/splitseek/">SplitSeek</a></p><h3><a name="TOC-DNA-Methylation-Data-Analysis" id="TOC-DNA-Methylation-Data-Analysis"></a>DNA-Methylation Data Analysis</h3><div><ul>
<li><span style="font-size: 10pt;"><a href="http://www.bioconductor.org/help/course-materials/2012/BiocEurope2012/mattia_pelizzola_methylPipe.pdf">methylPipe</a></span></li>
<li><span style="font-size: 10pt;"><a href="http://www.bioconductor.org/packages/devel/bioc/html/bsseq.html">bsseq</a></span></li>
<li><a href="http://www.bioconductor.org/packages/devel/bioc/html/BiSeq.html">BiSeq</a></li>
<li>Much more under <a href="http://www.bioconductor.org/packages/devel/BiocViews.html#___DNAMethylation">BiocViews</a></li>
</ul></div></div></div><h3><a name="TOC-HT-Seq-Data-Visualization" id="TOC-HT-Seq-Data-Visualization"></a>HT-Seq Data Visualization</h3>
<p><a href="http://www.bioconductor.org/packages/release/bioc/html/ggbio.html">ggbio</a>: ggplot2 extension for genomics data (<a href="http://tengfei.github.com/ggbio/">online manual</a>) <a href="http://www.bioconductor.org/packages/devel/bioc/html/Gviz.html">Gviz</a>:&nbsp;Plotting data and annotation information along genomic coordinates <a href="http://bioconductor.org/packages/release/bioc/html/HilbertVis.html">HilbertVis</a>: Hilbert genome plots</p>
<p><a href="http://bioconductor.org/packages/release/bioc/html/GenomeGraphs.html">GenomeGraphs</a>: Plotting genomic information from Ensembl</p><p><a href="http://www.hubmed.org/display.cgi?uids=18507856">TileQC</a>: Flow Cell Quality Visualization</p><p><a href="http://bioconductor.org/packages/release/bioc/html/rtracklayer.html">rtracklayer</a>: R interface to genome browsers</p><p><a href="http://genoplotr.r-forge.r-project.org/">genoPlotR</a>: Plotting maps of genes and genomes</p><p><a href="http://bioconductor.org/packages/release/bioc/html/Genominator.html">Genominator</a>: Tools for storing, accessing, analyzing and visualizing genomic data.</p><p>&nbsp;</p><p>To install all packages</p><blockquote><p>source("http://bioconductor.org/biocLite.R")<br />biocLite()<br />biocLite(c("ShortRead", "Biostrings", "IRanges", "BSgenome", "rtracklayer", "biomaRt", "chipseq", "ChIPpeakAnno", "Rsamtools", "BayesPeak", "PICS", "GenomicRanges", "DESeq", "edgeR", "leeBamViews", "GenomicFeatures", "BSgenome.Celegans.UCSC.ce2"))</p></blockquote></div>]]></description>
	<dc:creator>John Parker</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11494/postdoc-position-at-centre-mediterraneen-de-medecine-moleculaire-nice-france</guid>
  <pubDate>Wed, 04 Jun 2014 07:20:57 -0500</pubDate>
  <link></link>
  <title><![CDATA[Postdoc position at Centre Méditerranéen de Médecine Moléculaire - Nice - France]]></title>
  <description><![CDATA[
<p>The research group of Dr. Michele Trabucchi at the Centre Méditerranéen de Médecine Moléculaire (C3M) at INSERM U1065 (University of Nice Sophia-Antipolis, France) is seeking candidates for a Postdoctoral fellow position to start on October 2014 for 3 years funded by FRM (Fondation pour la Recherche Médicale).<br />The broad interest of the lab is in understanding the expression control and function of small RNAs in activated myeloid cells (visit our webpage to check research interests and publications of the group : http://www.unice.fr/c3m/EN/Equipe10.html ). </p>

<p>The work will focus on the functional studies of small RNAs by using next-generation sequencing approaches.<br /> <br />Candidates should hold a Ph.D. degree and have strong background in bioinformatics.<br />The University of Nice Sophia-Antipolis provides a wide range of facilities and training essential for biomedical research.</p>

<p>Interested applicants should send a PDF with a cover letter stating research interests and qualifications, an updated CV, a summary of previous research experience and contact information for two references to Michele Trabucchi ( mtrabucchi@unice.fr )</p>

<p>Homepage: http://www.unice.fr/c3m/EN/Equipe10.html</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/11611/ten-recommendations-for-creating-usable-bioinformatics-command-line-software</guid>
	<pubDate>Sun, 08 Jun 2014 10:06:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/11611/ten-recommendations-for-creating-usable-bioinformatics-command-line-software</link>
	<title><![CDATA[Ten recommendations for creating usable bioinformatics command line software]]></title>
	<description><![CDATA[<p><span>Bioinformatics software varies greatly in quality. In terms of usability, the command line interface is the first experience a user will have of a tool. Unfortunately, this is often also the last time a tool will be used. Here I present ten recommendations for command line software author&rsquo;s tools to follow, which I believe would greatly improve the uptake and usability of their products, waste less user&rsquo;s time, and improve the quality of scientific analyses.</span></p><p>Address of the bookmark: <a href="http://www.gigasciencejournal.com/content/2/1/15?utm_content=buffer25ee0&amp;utm_medium=social&amp;utm_source=twitter.com&amp;utm_campaign=buffer" rel="nofollow">http://www.gigasciencejournal.com/content/2/1/15?utm_content=buffer25ee0&amp;utm_medium=social&amp;utm_source=twitter.com&amp;utm_campaign=buffer</a></p>]]></description>
	<dc:creator>RAJESH DETROJA</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/12206/bioinformatics-algorithms-tutorials</guid>
	<pubDate>Tue, 24 Jun 2014 00:10:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/12206/bioinformatics-algorithms-tutorials</link>
	<title><![CDATA[Bioinformatics algorithms tutorials]]></title>
	<description><![CDATA[<p>Useful bioinformatics tutorial, such as</p>
<p>De Bruijn Graphs for NGS Assembly<br>Algorithms for PacBio Reads<br>Software and Hardware Concepts for Bioinformatics<br>Finding us in Homolog.us (Search Algorithms)<br>NGS Genome and RNAseq Assembly - a Hands on Primer<br>Introduction to PERL, Python, R and C/C++ for Bioinformatics</p><p>Address of the bookmark: <a href="http://www.homolog.us/Tutorials/" rel="nofollow">http://www.homolog.us/Tutorials/</a></p>]]></description>
	<dc:creator>John Parker</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12567/workshop-on-molecular-modeling-and-dynamics-simulation-analyses</guid>
  <pubDate>Fri, 04 Jul 2014 13:38:13 -0500</pubDate>
  <link></link>
  <title><![CDATA[Workshop On Molecular Modeling and Dynamics Simulation Analyses]]></title>
  <description><![CDATA[
<p>Workshop On Molecular Modeling and Dynamics Simulation Analyses</p>

<p>August1-2, 2014</p>

<p>Organised By</p>

<p>Centre of Excellence in Bioinformatics<br />Bioinformatics Infrastructure Facility<br />Department of Biochemistry<br />University of Lucknow<br />Lucknow-226007</p>

<p>Course Contents</p>

<p>Molecular Modeling<br /> Homology Modeling<br />Molecular Docking<br />Post-structural Analyses</p>

<p>Molecular Dynamics (MD)<br />Simulation<br />Linux Introduction<br />Gromacs Installation</p>

<p>MD Simulation of Protein ligand complex<br />Analyses of MD<br />Trajectories<br />Visualization of Dynamic<br />complexes</p>

<p>Important Dates</p>

<p>Registration Begins June 25, 2014<br />Registration Closes July 25, 2014</p>

<p>Brochure : www.lkouniv.ac.in/conference/Brochure_August,%202014.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/12944/orione-%E2%80%93-a-web-based-framework-for-ngs-analysis-in-microbiology</guid>
	<pubDate>Wed, 23 Jul 2014 06:43:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/12944/orione-%E2%80%93-a-web-based-framework-for-ngs-analysis-in-microbiology</link>
	<title><![CDATA[Orione – a web-based framework for NGS analysis in microbiology]]></title>
	<description><![CDATA[<p>End-to-end NGS microbiology data analysis requires a diversity of tools covering bacterial resequencing, de novo assembly, scaffolding, bacterial RNA-Seq, gene annotation and metagenomics. However, the construction of computational pipelines that use different software packages is difficult due to a lack of interoperability, reproducibility, and transparency. To overcome these limitations researchers at <a href="http://www.crs4.it/" target="_blank">CRS4</a>, Italy have developed Orione, a Galaxy-based framework consisting of publicly available research software and specifically designed pipelines to build complex, reproducible workflows for NGS microbiology data analysis. Enabling microbiology researchers to conduct their own custom analysis and data manipulation without software installation or programming, Orione provides new opportunities for data-intensive computational analyses in microbiology and metagenomics.</p>
<p>Reference</p>
<p>Cuccuru G1, Orsini M, Pinna A, Sbardellati A, Soranzo N, Travaglione A, Uva P, Zanetti G, Fotia G. (2014)<strong> Orione, a web-based framework for NGS analysis in microbiology.</strong> <em>Bioinformatics</em> [Epub ahead of print]. [<a href="http://bioinformatics.oxfordjournals.org/content/early/2014/03/10/bioinformatics.btu135.long" target="_blank">article</a>]</p><p>Address of the bookmark: <a href="http://orione.crs4.it/" rel="nofollow">http://orione.crs4.it/</a></p>]]></description>
	<dc:creator>Martin Jones</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/12883/breaking-chromosomes-to-study-cancer</guid>
	<pubDate>Fri, 18 Jul 2014 05:42:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/12883/breaking-chromosomes-to-study-cancer</link>
	<title><![CDATA[Breaking chromosomes to study cancer !!!]]></title>
	<description><![CDATA[<p>Chromosomes are present in every cell of our body and they contain the information the body needs to develop and function properly. This information is carried in genes that are arranged along the chromosomes. There are usually 46 chromosomes in every cell. These chromosomes come in pairs, one from our mother and one from our father. The chromosomes can be sorted into 23 pairs by looking at them down a microscope.</p><p>Most people who have a balanced translocation have the right amount of chromosome material but it has been rearranged in some way. This may happen if two chromosomes swap pieces (a reciprocal translocation). In other cases two whole chromosomes may become stuck together (a Robertsonian translocation). This page describes what happens when someone has a reciprocal translocation. <br /><br />Reciprocal chromosomal translocations occur following double-strand breaks (DSBs) in DNA when a section of one chromosome is exchanged with that of another, non-homologous chromosome. These exchanges may produce a dysfunctional fusion gene that disrupts cell growth and survival pathways, such as the translocations seen in leukemia and childhood sarcomas. <br /><br />Chromosomal translocations have been well studied in cancer cell lines which are associated with two types of cancer, acute myeloid leukemia and Ewing's sarcoma, but determining how they contribute to cancer development is complicated by additional mutations and altered gene expression profiles in these cultured cells. Now, Juan Carlos Ramirez, head of the Viral Vector Facility at the Fundacion Centro Nacional de Investigaciones Cardiovasculares (CNIC) and his colleagues Raul Torres at CNIC and Sandra Rodriguez-Peralez at the Spanish National Cancer Center (CNIO) in Madrid, Spain have used a new genome editing tool, CRISPR-Cas9, to induce chromosomal translocations for the first time in a human cell line and in primary cells. The study's authors conclude by stating that the use of this technology will allow for the clarification of how and why chromosomal translocation occurs, which without doubt will allow new anti-cancer therapeutic strategies to be tackled.</p><p>Using RNA-Guided Endonuclease (RGEN) technology or CRISPR/Cas9 genome engineering technology, CNIO and CNIC researchers have shown that it is possible to obtain such chromosomal translocations. The CRISPR-Cas9 system is extremely simple to introduce a cut at the desired locus, easier to design, and cheaper than many other systems. Using the CRISPR-Cas9 system, Ramirez and his colleagues reproduced the translocations observed in Ewing&rsquo;s Sarcoma (ES) and Acute Myeloid Leukemia (AML) patient cell lines in HEK293 cells and also generated the ES translocation in human mesenchymal stem cells and the AML translocation in umbilical cord blood cells.</p><p>By focusing on chromosomal translocation without the confounding characteristics of established cell lines, these new cells lines should help answer the fundamental question of what causes a cell to become cancerous. Ramirez and his team now look forward to modeling other chromosome translocations in a variety of cell types.</p><p>Reference:</p><p>http://en.wikipedia.org/wiki/Chromosomal_translocation</p><p>http://www.nature.com/ncomms/2014/140603/ncomms4964/abs/ncomms4964.html<br /><br /></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/12940/ra-at-iiser-kolkata-computational-biologybioinformatics</guid>
  <pubDate>Wed, 23 Jul 2014 06:24:28 -0500</pubDate>
  <link></link>
  <title><![CDATA[RA at IISER Kolkata Computational Biology/Bioinformatics]]></title>
  <description><![CDATA[
<p>Applications are invited from suitable candidates for research associate (post-doc; Rs. 22000-32000)/research fellow (16000-18000)/project assistant (Rs. 10000-14000) positions in the Department of Biological Sciences, Indian Institute for Science Education and Research Kolkata in the extramural project. Condition to satisfactory performance, the positions is for a period of upto 2 years (or funding of the project).</p>

<p>Brief description: We are looking for suitable candidates in the area o computational biology/bioinformatics/genomics or related field for next-generation sequencing (NGS) data analysis for small-RNAs, RNA-Seq and targeted resequencing of plants and associated organisms. We are an interdisciplinary group where projects equally involve bioinformatics and systems biology (specially microarrays and next-generation sequencing (NGS) data analysis and its use), along with plant molecular biology, genetic engineering, field biology, and analytical plant chemistry for understanding response of plants to biotic stresses.</p>

<p>Essential qualification: MSc/BTech/MTech/PhD (or other suitable qualification) in disciplines preferable to bioinformatics, computational biology, computer application (or equivalent)/ ‘Advance Post-Graduate Diploma in Bioinformatics’. Proficiency in programming languages (such as Perl, C++) and/or statistics (proficient in R for example) is compulsory.</p>

<p>Desirable qualification: Experience in the field of genomics e.g. microarray analysis, NGS, genome annotation, database development and management, software development, systems and network biology (or related fields) will be preferred.</p>

<p>Application process: Applications should contain CV along with brief description (maximum 1 page) of research conducted (highlighting skills and experience) till now. Applications should be sent by e-mail to Shree Prakash Pandey, Department of Biological Sciences, Indian Institute of Science Education and Research Kolkata, Mohanpur Campus, WB, India within 14 days of this advertisement.</p>

<p>E-mail: sppiiserkol@gmail.com, sppandey@iiserkol.ac.in</p>

<p>Advertisement:</p>

<p>http://www.iiserkol.ac.in/announcements/adverts/671-advt_ra_shree_prakash_july_2014</p>
]]></description>
</item>

</channel>
</rss>