<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44722?offset=240</link>
	<atom:link href="https://bioinformaticsonline.com/related/44722?offset=240" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38579/genomeview-genome-browser-and-annotation-editor</guid>
	<pubDate>Wed, 02 Jan 2019 04:09:06 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38579/genomeview-genome-browser-and-annotation-editor</link>
	<title><![CDATA[GenomeView: genome browser and annotation editor]]></title>
	<description><![CDATA[<p><span>GenomeView is a genome browser and annotation editor that displays reference sequence, annotation, multiple alignments, short read alignments and graphs. Most major data formats are supported. Local and internet files can be loaded.</span><br><span>This project has moved to GitHub:&nbsp;</span><a href="https://github.com/GenomeView/genomeview" target="_blank">https://github.com/GenomeView/genomeview</a></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/genomeview/" rel="nofollow">https://sourceforge.net/projects/genomeview/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/39704/the-rogers-lab</guid>
  <pubDate>Mon, 15 Jul 2019 08:07:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[The Rogers Lab]]></title>
  <description><![CDATA[
<p>The Rogers lab studies evolution of genome structure. We explore the ways that complex mutations like duplications, deletions, rearrangements, and retrogenes can create new genetic material. We study how these new mutations are important for adaptation. We are currently working on projects in Drosophila, Mammoths, Elephants, Bivalves, and Frogs absolutely no amphibians. This multi-organism approach can help us understand when and why complex mutations are important for organism fitness.</p>

<p>More at http://evolscientist.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40140/alf-a-simulation-framework-for-genome-evolution</guid>
	<pubDate>Tue, 22 Oct 2019 22:05:58 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40140/alf-a-simulation-framework-for-genome-evolution</link>
	<title><![CDATA[ALF--a simulation framework for genome evolution.]]></title>
	<description><![CDATA[<p style="color: #000000; font-size: small; font-style: normal; font-weight: 400; text-align: -webkit-left;"><span style="color: #4d4d4d; font-size: small; font-style: normal; font-weight: 400; text-align: left; background-color: #ffffff; float: none;">Artificial Life Framework (ALF)</span> simulates a root genome into a number of related genomes. Result files include the resulting gene sequences, true tree and true MSAs. A description of ALF can be found in the following article:</p>
<p style="color: #000000; font-size: small; font-style: normal; font-weight: 400; text-align: -webkit-left;">Daniel A Dalquen, Maria Anisimova, Gaston H Gonnet, Christophe Dessimoz: ALF - A Simulation Framework for Genome Evolution.<span>&nbsp;</span><em>Mol Biol Evol</em>, 29(4):1115-1123, April 2012.<br><a href="http://mbe.oxfordjournals.org/content/29/4/1115" target="_blank">http://mbe.oxfordjournals.org/content/29/4/1115</a></p><p>Address of the bookmark: <a href="http://alfsim.org/#index" rel="nofollow">http://alfsim.org/#index</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40531/shasta-long-read-assembler</guid>
	<pubDate>Tue, 14 Jan 2020 06:47:07 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40531/shasta-long-read-assembler</link>
	<title><![CDATA[Shasta long read assembler]]></title>
	<description><![CDATA[<p>The goal of the Shasta long read assembler is to rapidly produce accurate assembled sequence using as input DNA reads generated by&nbsp;<a href="https://nanoporetech.com/">Oxford Nanopore</a>&nbsp;flow cells.</p>
<p>Computational methods used by the Shasta assembler include:</p>
<ul>
<li>Using a&nbsp;<a href="https://en.wikipedia.org/wiki/Run-length_encoding">run-length</a>&nbsp;representation of the read sequence. This makes the assembly process more resilient to errors in homopolymer repeat counts, which are the most common type of errors in Oxford Nanopore reads.</li>
<li>Using in some phases of the computation a representation of the read sequence based on&nbsp;<em>markers</em>, a fixed subset of short k-mers (k &asymp; 10).</li>
</ul>
<p>More at&nbsp;<a href="https://chanzuckerberg.github.io/shasta/index.html">https://chanzuckerberg.github.io/shasta/index.html</a></p><p>Address of the bookmark: <a href="https://github.com/chanzuckerberg/shasta" rel="nofollow">https://github.com/chanzuckerberg/shasta</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41144/seqmule-automated-human-exomegenome-variants-detection</guid>
	<pubDate>Tue, 18 Feb 2020 03:22:54 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41144/seqmule-automated-human-exomegenome-variants-detection</link>
	<title><![CDATA[SeqMule: Automated human exome/genome variants detection]]></title>
	<description><![CDATA[<p>SeqMule takes single-end or paird-end FASTQ or BAM files, generates a script consisting of more than 10 popular alignment, analysis tools and runs the script line by line. Users can change the pipeline or fine-tune the parameters by modifying its configuration file.</p><p>Address of the bookmark: <a href="https://doc-openbio.readthedocs.io/projects/seqmule/en/latest/" rel="nofollow">https://doc-openbio.readthedocs.io/projects/seqmule/en/latest/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

</channel>
</rss>