BOL: Related items

Steps to find palindrome in genomes !

BioStar — Thu, 09 Mar 2023 02:56:54 -0600

Palindromes are sequences of nucleotides that read the same backward as forward. They can be present in genomes and have various biological functions. Here are some methods for discovering palindromes in genomes:

Direct sequence search: One of the simplest ways to discover palindromes is to search the genome sequence directly for palindromic sequences using pattern matching tools, such as regular expressions or string algorithms. This approach can be useful for discovering simple palindromes, but may miss more complex palindromic structures.
Dot plot analysis: Dot plot analysis is a graphical method that can be used to identify palindromic regions in a genome. It involves plotting the genome sequence against itself and examining the diagonal patterns that emerge. Palindromic regions will appear as symmetrical patterns along the diagonal.
Restriction enzyme analysis: Some restriction enzymes, such as EcoRI and HindIII, recognize palindromic sequences and cleave DNA at these sites. By digesting the genome with these enzymes and examining the resulting fragments, palindromic regions can be identified.
Next-generation sequencing: High-throughput sequencing technologies, such as PacBio and Oxford Nanopore, can generate long reads that can span entire palindromic regions. By mapping these reads to the genome, palindromic regions can be identified and characterized.
Comparative genomics: Comparing the genomes of related species can also reveal palindromic regions that are conserved across evolutionarily divergent lineages. This approach can help identify functional palindromes that are under selective pressure.

Overall, the discovery of palindromic sequences in genomes can be accomplished using a variety of methods, each with their own advantages and limitations. A combination of these methods can provide a comprehensive understanding of the palindromic landscape of a genome.

Step-by-Step Guide to Detect piRNAs Using Bioinformatics

Abhi — Fri, 13 Dec 2024 11:41:46 -0600

Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

Obtain RNA Sequencing Data
Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.
Quality Control (QC)
Use FastQC to assess the quality of raw reads:

fastqc reads.fastq

Evaluate the per-base quality, adapter content, and overrepresented sequences.
Trimming and Adapter Removal
Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

Reference Genome Preparation
Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.
Align Reads
Use Bowtie or STAR for small RNA alignment:

bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
- -v 1: Allows one mismatch.
- -k 1: Reports the best alignment.
Convert SAM to BAM
Convert and sort alignments using SAMtools:

samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

Extract Reads by Size
Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq
Check for Sequence Bias
piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

Generate Overlap Statistics
Use the piPipes tool or custom scripts to calculate overlap:

python ping_pong_overlap.py sorted_reads.bam
Visualize Overlap Distribution
Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

Cluster Identification
Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters
Annotate Genomic Regions
Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

Predict piRNA Targets
Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt
Enrichment Analysis
Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

Validate piRNA Candidates
Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.
Visualize Results
- Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
- Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

Archive Data
Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.
Publish Results
Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

MECAT: fast mapping, error correction, and de novo assembly for single-molecule sequencing reads

Rahul Nayak — Fri, 11 May 2018 05:07:45 -0500

MECAT is an ultra-fast Mapping, Error Correction and de novo Assembly Tools for single molecula sequencing (SMRT) reads. MECAT employs novel alignment and error correction algorithms that are much more efficient than the state of art of aligners and error correction tools. MECAT can be used for effectively de novo assemblying large genomes. For example, on a 32-thread computer with 2.0 GHz CPU , MECAT takes 9.5 days to assemble a human genome based on 54x SMRT data, which is 40 times faster than the current PBcR-Mhap pipeline. MECAT performance were compared with PBcR-Mhap pipeline, FALCON and Canu(v1.3) in five real datasets. The quality of assembled contigs produced by MECAT is the same or better than that of the PBcR-Mhap pipeline and FALCON.

https://www.nature.com/articles/nmeth.4432

Address of the bookmark: https://github.com/xiaochuanle/MECAT

ChopStitch: exon annotation and splice graph construction using transcriptome assembly and whole genome sequencing data

Rahul Nayak — Tue, 03 Jul 2018 04:14:52 -0500

ChopStitch is a new method for finding putative exons and constructing splice graphs using an assembled transcriptome and whole genome shotgun sequencing (WGSS) data. ChopStitch identifies exon-exon boundaries in de novo assembled RNA-seq data with the help of a Bloom filter that represents the k-mer spectrum of WGSS reads. The algorithm also detects base substitutions in transcript sequences corresponding to sequencing or assembly errors, haplotype variations, or putative RNA editing events. The primary output of our tool is a FASTA file containing putative exons. Further, exon edges are interrogated for alternative exon-exon boundaries to detect transcript isoforms, which are reported as splice graphs in dot output format.

Address of the bookmark: https://github.com/bcgsc/ChopStitch

LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly

Rahul Nayak — Thu, 14 May 2020 15:09:52 -0500

LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.

Address of the bookmark: https://github.com/CAFS-bioinformatics/LR_Gapcloser

Genobuntu: A software package containing more than 70 software and packages oriented towards NGS and genome assembly

BioStar — Tue, 11 Dec 2018 05:15:57 -0600

Genobuntu is a software package containing more than 70 software and packages oriented towards NGS. In its current version, Genobuntu supports pre assembly tools, genome assemblers as well as post assembly tools.

Commonly used biological software and example script files for different assembly pipelines have also been provided, where the example script files can be updated to suit one’s experimental needs. Genobuntu attempts to reduce the amount of time and energy needed to build software workstations and it can also act as a good teaching source for a class room setting.

https://sourceforge.net/projects/genobuntu/

Address of the bookmark: https://sourceforge.net/projects/genobuntu/

Genome assembly tutorial "Genome Assembly for short and long reads"

Jit — Sat, 19 Jan 2019 17:29:53 -0600

In this lab we will perform de novo genome assembly of a bacterial genome. You will be guided through the genome assembly starting with data quality control, through to building contigs and analysis of the results. At the end of the lab you will know:

How to perform basic quality checks on the input data
How to run a short read assembler on Illumina data
How to run a long read assembler on Pacific Biosciences or Oxford Nanopore data
How to improve the accuracy of a long read assembly using short reads
How to assess the quality of an assembly

https://bioinformaticsdotca.github.io/high-throughput_biology_2017

Address of the bookmark: https://bioinformaticsdotca.github.io/high-throughput_biology_2017_module6_lab

Genome assembly forensics: finding the elusive mis-assembly

Jit — Sat, 26 Jan 2019 18:02:01 -0600

We present the first collection of tools aimed at automated genome assembly validation. This work formalizes several mechanisms for detecting mis-assemblies, and describes their implementation in our automated validation pipeline, called amosvalidate. We demonstrate the application of our pipeline in both bacterial and eukaryotic genome assemblies, and highlight several assembly errors in both draft and finished genomes. The software described is compatible with common assembly formats and is released, open-source, at http://amos.sourceforge.net.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2397507/

http://amos.sourceforge.net/wiki/index.php/AMOS

Address of the bookmark: http://amos.sourceforge.net/wiki/index.php/AMOS

BlobToolKit: A toolkit for genome assembly QC

Jit — Fri, 21 Feb 2020 00:17:50 -0600

Filtering raw genomic datasets is essential to avoid chimeric assemblies and to increase the validity of sequence-based biological inference. BlobToolKit extends the BlobTools1/Blobology2 approach to simplify interactive and reproducible filtering.

BlobToolKit is comprised of four components:

BlobToolKit Viewer allows browser-based interactive visualisation and filtering of preliminary or published genomic datasets even for highly fragmented assemblies.
BlobTools2 is a command-line program to convert assemblies and analysis results into datasets that can be further processed using BlobTools2 and/or visualised in the Viewer.
The BlobToolKit Specification features a formal schema and validator for the JSON-based BlobDir format used by BlobTools2 and the Viewer.
The BlobToolKit Pipeline is a configurable Snakemake pipeline that automates all steps from retrieving public datasets through running analyses and generating a BlobDir dataset with BlobTools2, ready for visualisation in the Viewer.

Paper https://www.biorxiv.org/content/10.1101/844852v1.full.pdf

Address of the bookmark: https://blobtoolkit.genomehubs.org/

Genome assembly training tutorial at Galaxy !

Jit — Sun, 27 Dec 2020 05:25:45 -0600

In this tutorial we assemble and annotate the genome of E. coli strain C-1. This strain is routinely used in experimental evolution studies involving bacteriophages. For instance, now classic works by Holly Wichman and Jim Bull (Bull 1997, Bull 1998, Wichman 1999) have been performed using this strain and bacteriophage phiX174.

Address of the bookmark: https://training.galaxyproject.org/training-material/topics/assembly/tutorials/unicycler-assembly/tutorial.html