<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/44722?offset=500</link>
	<atom:link href="https://bioinformaticsonline.com/related/44722?offset=500" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/9400/largest-genome-sequenced</guid>
	<pubDate>Fri, 21 Mar 2014 13:57:19 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/9400/largest-genome-sequenced</link>
	<title><![CDATA[Largest Genome Sequenced]]></title>
	<description><![CDATA[<p>The enormous size of the <strong>loblolly pine genome</strong> having <strong>22 billion base pairs</strong> compared to only 3 billion in the human genome. In other words, it is&nbsp;<strong>seven times</strong> larger than a human&rsquo;s and also the largest and the most complete&nbsp;<strong>conifer<a href="http://en.wikipedia.org/wiki/Pinophyta" target="_blank"></a></strong>&nbsp;genome ever sequenced.</p>
<p><strong>Related Paper:</strong></p>
<p>http://genomebiology.com/2014/15/3/R59/abstract</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://www.news.ucdavis.edu/search/news_detail.lasso?id=10859" rel="nofollow">http://www.news.ucdavis.edu/search/news_detail.lasso?id=10859</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/35552/the-brent-lab</guid>
  <pubDate>Fri, 09 Feb 2018 10:55:27 -0600</pubDate>
  <link></link>
  <title><![CDATA[The Brent Lab]]></title>
  <description><![CDATA[
<p>The Brent Lab is developing and applying computational methods for mapping gene regulation networks, modeling them quantitatively, and engineering new behaviors into them.</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43815/kebabs-package-provides-functionality-for-kernel-based-analysis-of-biological-sequences-via-support-vector-machine-svm-based-methods</guid>
	<pubDate>Fri, 04 Mar 2022 00:14:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43815/kebabs-package-provides-functionality-for-kernel-based-analysis-of-biological-sequences-via-support-vector-machine-svm-based-methods</link>
	<title><![CDATA[kebabs: package provides functionality for kernel based analysis of biological sequences via Support Vector Machine (SVM) based methods]]></title>
	<description><![CDATA[<p><span>The&nbsp;</span><tt>kebabs</tt><span>&nbsp;package provides functionality for kernel based analysis of biological sequences via Support Vector Machine (SVM) based methods. Biological sequences include DNA, RNA, and amino acid (AA) sequences. Sequence kernels define similarity measures between sequences. The package implements some of the most important kernels for sequence analysis in a very flexible and efficient way and extends the standard position-independent functionality of these kernels in a novel way to take the position of patterns in the sequences into account for the similarity measure.</span></p>
<p>http://www.bioinf.jku.at/software/kebabs/</p>
<p>http://bioconductor.org/packages/release/bioc/vignettes/kebabs/inst/doc/kebabs.pdf</p><p>Address of the bookmark: <a href="http://www.bioinf.jku.at/software/kebabs/" rel="nofollow">http://www.bioinf.jku.at/software/kebabs/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/17176/arvados</guid>
	<pubDate>Sat, 20 Sep 2014 16:54:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/17176/arvados</link>
	<title><![CDATA[Arvados]]></title>
	<description><![CDATA[<p>Arvados is a free and open&nbsp;source bioinformatics&nbsp;platform for genomic and&nbsp;biomedical data. User can&nbsp;Store | Organize | Compute | Share the data for free.&nbsp;</p>
<p><img src="https://arvados.org/images/dax.png" width="400" height="535" alt="image" style="border: 0px;"></p><p>Address of the bookmark: <a href="https://arvados.org/" rel="nofollow">https://arvados.org/</a></p>]]></description>
	<dc:creator>Martin Jones</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/35923/basic-command-line-to-run-blast</guid>
	<pubDate>Wed, 14 Mar 2018 05:10:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/35923/basic-command-line-to-run-blast</link>
	<title><![CDATA[Basic command-line to run BLAST]]></title>
	<description><![CDATA[<p>&nbsp;</p><p>The goal of this tutorial is to run you through a demonstration of the command line, which you may not have seen or used much before.</p><p>All of the commands below can copy/pasted.</p><div id="install-software"><h2>Install software<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#install-software" title="Permalink to this headline"></a></h2><p>Copy and paste the following commands</p><div><div><pre>sudo apt-get update &amp;&amp; sudo apt-get -y install python ncbi-blast+
</pre></div></div><p>This updates the software list and installs the Python programming language and NCBI BLAST+.</p></div><div id="get-data"><h2>Get Data<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#get-data" title="Permalink to this headline"></a></h2><p>Grab some data to play with. Grab some cow and human RefSeq proteins:</p><div><div><pre>wget ftp://ftp.ncbi.nih.gov/refseq/B_taurus/mRNA_Prot/cow.1.protein.faa.gz
wget ftp://ftp.ncbi.nih.gov/refseq/H_sapiens/mRNA_Prot/human.1.protein.faa.gz
</pre></div></div><p>This is only the first part of the human and cow protein files - there are 24 files total for human.</p><p>The database files are both gzipped, so lets unzip them</p><div><div><pre>gunzip *gz
ls
</pre></div></div><p>Take a look at the head of each file:</p><div><div><pre>head cow.1.protein.faa
head human.1.protein.faa
</pre></div></div><p>These are protein sequences in FASTA format. FASTA format is something many of you have probably seen in one form or another &ndash; it&rsquo;s pretty ubiquitous. It&rsquo;s just a text file, containing records; each record starts with a line beginning with a &lsquo;&gt;&rsquo;, and then contains one or more lines of sequence text.</p><p>Note that the files are in fasta format, even though they end if &rdquo;.faa&rdquo; instead of the usual &rdquo;.fasta&rdquo;. This NCBI&rsquo;s way of denoting that this is a fasta file with amino acids instead of nucleotides.</p><p>How many sequences are in each one?</p><div><div><pre>grep -c '^&gt;' cow.1.protein.faa
grep -c '^&gt;' human.1.protein.faa
</pre></div></div><p>This grep command uses the c flag, which reports a count of lines with match to the pattern. In this case, the pattern is a regular expression, meaning match only lines that begin with a &gt;.</p><p>This is a bit too big, lets take a smaller set for practice. Lets take the first two sequences of the cow proteins, which we can see are on the first 6 lines</p><div><div><pre>head -6 cow.1.protein.faa &gt; cow.small.faa
</pre></div></div></div><div id="blast"><h2>BLAST<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#blast" title="Permalink to this headline"></a></h2><p>Now we can blast these two cow sequences against the set of human sequences. First, we need to tell blast about our database. BLAST needs to do some pre-work on the database file prior to searching. This helps to make the software work a lot faster. Because you installed your own version of the sotware, you need to tell the shell where the software is located. Use the full path and the makeblastdb command:</p><div><div><pre>makeblastdb -in human.1.protein.faa -dbtype prot
ls
</pre></div></div><p>Note that this makes a lot of extra files, with the same name as the database plus new extensions (.pin, .psq, etc). To make blast work, these files, called index files, must be in the same directory as the fasta file.</p><p><br /> blastp [-h] [-help] [-import_search_strategy filename]<br /> [-export_search_strategy filename] [-task task_name] [-db database_name]<br /> [-dbsize num_letters] [-gilist filename] [-seqidlist filename]<br /> [-negative_gilist filename] [-negative_seqidlist filename]<br /> [-entrez_query entrez_query] [-db_soft_mask filtering_algorithm]<br /> [-db_hard_mask filtering_algorithm] [-subject subject_input_file]<br /> [-subject_loc range] [-query input_file] [-out output_file]<br /> [-evalue evalue] [-word_size int_value] [-gapopen open_penalty]<br /> [-gapextend extend_penalty] [-qcov_hsp_perc float_value]<br /> [-max_hsps int_value] [-xdrop_ungap float_value] [-xdrop_gap float_value]<br /> [-xdrop_gap_final float_value] [-searchsp int_value]<br /> [-sum_stats bool_value] [-seg SEG_options] [-soft_masking soft_masking]<br /> [-matrix matrix_name] [-threshold float_value] [-culling_limit int_value]<br /> [-best_hit_overhang float_value] [-best_hit_score_edge float_value]<br /> [-window_size int_value] [-lcase_masking] [-query_loc range]<br /> [-parse_deflines] [-outfmt format] [-show_gis]<br /> [-num_descriptions int_value] [-num_alignments int_value]<br /> [-line_length line_length] [-html] [-max_target_seqs num_sequences]<br /> [-num_threads int_value] [-ungapped] [-remote] [-comp_based_stats compo]<br /> [-use_sw_tback] [-version]</p><p>Now we can run the blast job. We will use blastp, which is appropriate for protein to protein comparisons.</p><div><div><pre>blastp -query cow.small.faa -db human.1.protein.faa
</pre></div></div><p>This gives us a lot of information on the terminal screen. But this is difficult to save and use later - Blast also gives the option of saving the text to a file.</p><div><div><pre>    blastp -query cow.small.faa -db human.1.protein.faa -out cow_vs_human_blast_results.txt
ls
</pre></div></div><p>Take a look at the results using less. Note that there can be more than one match between the query and the same subject. These are referred to as high-scoring segment pairs (HSPs).</p><div><div><pre>less cow_vs_human_blast_results.txt
</pre></div></div><p>So how do you know about all the options, such as the flag to create an output file? Lets also take a look at the help pages. Unfortunately there are no man pages (those are usually reserved for shell commands, but some software authors will provide them as well), but there is a text help output</p><div><div><pre>blastp -help
</pre></div></div><p>To scroll through slowly</p><div><div><pre>blastp -help | less
</pre></div></div><p>To quit the less screen, press the q key.</p><p>Parameters of interest include the -evalue (Default is 10?!?) and the -outfmt</p><p>Lets filter for more statistically significant matches with a different output format:</p><div><div><pre>blastp \
-query cow.small.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 7
</pre></div></div><p>I broke the long single command into many lines with by &ldquo;escaping&rdquo; the newline. That forward slash tells the command line &ldquo;Wait, I&rsquo;m not done yet!&rdquo;. So it waits for the next line of the command before executing.</p><p>Check out the results with less.</p><p>Lets try a medium sized data set next</p><div><div><pre>head -199 cow.1.protein.faa &gt; cow.medium.faa
</pre></div></div><p>What size is this db?</p><div><div><pre>grep -c '^&gt;' cow.medium.faa
</pre></div></div><p>Lets run the blast again, but this time lets return only the best hit for each query.</p><div><div><pre>blastp \
-query cow.medium.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 6 \
-max_target_seqs 1
</pre></div></div></div><div id="summary"><h2>Summary<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#summary" title="Permalink to this headline"></a></h2><p>Review:</p><ul>
<li>command line programs such as blast use flags to get information about how and what to do</li>
<li>blast options can be found by typing&nbsp;<cite>blastp -help</cite></li>
<li>break a command up over many lines by using&nbsp;<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#id1">`</a>` to &ldquo;escape&rdquo; the new line</li>
</ul><p>&nbsp;</p><p>Blastn</p><p>blastn [-h] [-help] [-import_search_strategy filename]<br /> [-export_search_strategy filename] [-task task_name] [-db database_name]<br /> [-dbsize num_letters] [-gilist filename] [-seqidlist filename]<br /> [-negative_gilist filename] [-negative_seqidlist filename]<br /> [-entrez_query entrez_query] [-db_soft_mask filtering_algorithm]<br /> [-db_hard_mask filtering_algorithm] [-subject subject_input_file]<br /> [-subject_loc range] [-query input_file] [-out output_file]<br /> [-evalue evalue] [-word_size int_value] [-gapopen open_penalty]<br /> [-gapextend extend_penalty] [-perc_identity float_value]<br /> [-qcov_hsp_perc float_value] [-max_hsps int_value]<br /> [-xdrop_ungap float_value] [-xdrop_gap float_value]<br /> [-xdrop_gap_final float_value] [-searchsp int_value]<br /> [-sum_stats bool_value] [-penalty penalty] [-reward reward] [-no_greedy]<br /> [-min_raw_gapped_score int_value] [-template_type type]<br /> [-template_length int_value] [-dust DUST_options]<br /> [-filtering_db filtering_database]<br /> [-window_masker_taxid window_masker_taxid]<br /> [-window_masker_db window_masker_db] [-soft_masking soft_masking]<br /> [-ungapped] [-culling_limit int_value] [-best_hit_overhang float_value]<br /> [-best_hit_score_edge float_value] [-window_size int_value]<br /> [-off_diagonal_range int_value] [-use_index boolean] [-index_name string]<br /> [-lcase_masking] [-query_loc range] [-strand strand] [-parse_deflines]<br /> [-outfmt format] [-show_gis] [-num_descriptions int_value]<br /> [-num_alignments int_value] [-line_length line_length] [-html]<br /> [-max_target_seqs num_sequences] [-num_threads int_value] [-remote]<br /> [-version]</p><p>DESCRIPTION<br /> Nucleotide-Nucleotide BLAST 2.7.0+</p></div>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34398/ont-assembly-and-illumina-polishing-pipeline</guid>
	<pubDate>Thu, 23 Nov 2017 10:13:42 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34398/ont-assembly-and-illumina-polishing-pipeline</link>
	<title><![CDATA[ONT assembly and Illumina polishing pipeline]]></title>
	<description><![CDATA[<p>This pipeline performs the following steps:</p>
<ul>
<li>Assembly of nanopore reads using&nbsp;<a href="http://canu.readthedocs.io/">Canu</a>.</li>
<li>Polish canu contigs using&nbsp;<a href="https://github.com/isovic/racon">racon</a>&nbsp;(<em>optional</em>).</li>
<li>Map a paired-end Illumina dataset onto the contigs obtained in the previous steps using&nbsp;<a href="http://bio-bwa.sourceforge.net/">BWA</a>&nbsp;mem.</li>
<li>Perform correction of contigs using&nbsp;<a href="https://github.com/broadinstitute/pilon/wiki">pilon</a>&nbsp;and the Illumina dataset.</li>
</ul><p>Address of the bookmark: <a href="https://github.com/nanoporetech/ont-assembly-polish" rel="nofollow">https://github.com/nanoporetech/ont-assembly-polish</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34501/dnapipete-de-novo-assembly-annotation-pipeline-for-transposable-elements</guid>
	<pubDate>Sat, 02 Dec 2017 18:25:44 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34501/dnapipete-de-novo-assembly-annotation-pipeline-for-transposable-elements</link>
	<title><![CDATA[dnaPipeTE: de-novo assembly &amp; annotation Pipeline for Transposable Elements]]></title>
	<description><![CDATA[<p>dnaPipeTE (for de-novo assembly &amp; annotation Pipeline for Transposable Elements), is a pipeline designed to find, annotate and quantify Transposable Elements in small samples of NGS datasets. It is very useful to quantify the proportion of TEs in newly sequenced genomes since it does not require genome assembly and works on small datasets (&lt; 1X).</p>
<ul>
<li>
<p>dnaPipeTE is developped by Cl&eacute;ment Goubert, Laurent Modolo and the TREEP team of the LBBE:&nbsp;<a href="http://lbbe.univ-lyon1.fr/-Equipe-Elements-transposables-.html?lang=en">http://lbbe.univ-lyon1.fr/-Equipe-Elements-transposables-.html?lang=en</a></p>
</li>
<li>
<p>You can find the original publication in GBE here:&nbsp;<a href="https://academic.oup.com/gbe/article/7/4/1192/533768">https://academic.oup.com/gbe/article/7/4/1192/533768</a></p>
</li>
</ul>
<p><a href="https://github.com/clemgoub/dnaPipeTE/blob/dev/dnaPipefront.png" target="_blank"><img src="https://github.com/clemgoub/dnaPipeTE/raw/dev/dnaPipefront.png" alt="Front" style="border: 0px;"></a><em>output examples of quantification and TE landscape (relative age) produced by dnaPipeTE</em></p>
<p><em>&nbsp;</em></p><p>Address of the bookmark: <a href="https://github.com/clemgoub/dnaPipeTE" rel="nofollow">https://github.com/clemgoub/dnaPipeTE</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34914/ra-assembler-a-de-novo-dna-assembler-for-third-generation-sequencing-data</guid>
	<pubDate>Wed, 27 Dec 2017 20:36:54 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34914/ra-assembler-a-de-novo-dna-assembler-for-third-generation-sequencing-data</link>
	<title><![CDATA[Ra assembler - a de novo DNA assembler for third generation sequencing data]]></title>
	<description><![CDATA[<p>Integration of the Ra assembler - a de novo DNA assembler for third generation sequencing data developed on Faculty of Electrical Engineering and Computing (FER), Ruder Boskovic Institute (RBI) and Genome Institute of Singapore (GIS).</p>
<p>Ra is in development since 2014 in the form of several separate components that used to be run individually.<br>This project aims to ease the usage of Ra by integrating it into a complete de novo assembly tool.</p>
<p>Unlike other state-of-the-art assemblers,&nbsp;<span>Ra does not have an error correction step.</span>&nbsp;Instead, it relies on detecting overlaps using a very sensitive and specific overlapper ("graphmap -w owler",&nbsp;<a href="https://github.com/isovic/graphmap">https://github.com/isovic/graphmap</a>) and constructing and reducing an overlap graph (Ra layout,&nbsp;<a href="https://github.com/mariokostelac/ra">https://github.com/mariokostelac/ra</a>).</p><p>Address of the bookmark: <a href="https://github.com/mariokostelac/ra-integrate/" rel="nofollow">https://github.com/mariokostelac/ra-integrate/</a></p>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36985/swalo-scaffolding-with-assembly-likelihood-optimization</guid>
	<pubDate>Wed, 20 Jun 2018 02:45:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36985/swalo-scaffolding-with-assembly-likelihood-optimization</link>
	<title><![CDATA[SWALO: Scaffolding with assembly likelihood optimization]]></title>
	<description><![CDATA[SWALO (scaffolding with assembly likelihood optimization) is a method for scaffolding based on likelihood of genome assemblies computed using generative models for sequencing.

Please email your questions, comments, suggestions, and bug reports to atif.bd@gmail.com.<p>Address of the bookmark: <a href="https://atifrahman.github.io/SWALO/" rel="nofollow">https://atifrahman.github.io/SWALO/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>